Review



algorithms imagelab biorad ver  (Bio-Rad)


Bioz Verified Symbol Bio-Rad is a verified supplier
Bioz Manufacturer Symbol Bio-Rad manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 99
      Buy from Supplier

    Structured Review

    Bio-Rad algorithms imagelab biorad ver
    Algorithms Imagelab Biorad Ver, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 36402 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/imaging+algorithms/Image+Lab+Software/pm41746804-125-133-135
    Average 99 stars, based on 36402 article reviews
    algorithms imagelab biorad ver - by Bioz Stars, 2026-09
    99/100 stars

    Images

    Related Articles

    Detection Assay:

    Article Title: The Ca 2+ sensor STIM1 promotes neuronal ferroptosis by regulating iron homeostasis to exacerbate brain injury after intracerebral hemorrhage.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER GSH/GSSG ratio detection assay kit Abcam Cat# ab205811 GPX4 activity assay kit Elabscience Cat# E-BC-K883-M Iron Assay Kit Elabscience Cat# E-BC-K772-M Iron Assay Kit Elabscience Cat# E-BC-K880-M Ferrous Iron Assay Kit Elabscience Cat# E-BC-K773-M Ferrous Iron Assay Kit Elabscience Cat# E-BC-K881-M Experimental models: Cell lines Mouse HT22 cell line Procell Cat# CL-0697 Human HEK-293F cell line Thermo Fisher Scientific Cat# R79007 Experimental models: Organisms/strains C57BL/6J mouse Fourth Military Medical University N/A STIM1 flox/flox mouse Shanghai Model Organisms N/A Nestin-Cre +/− mouse Shanghai Model Organisms N/A STIM1 flox/flox /Nestin-Cre +/− mouse Shanghai Model Organisms N/A Oligonucleotides STIM1 flox Primer 1 (Forward), 5 ′ -CAGGTTCAGTGAGACCCTGTC-3 ′ This paper N/A STIM1 flox Primer 2 (Reverse), 5 ′ -GCCCACCAAGATCTCCACAA-3 ′ This paper N/A Nestin-Cre Primer 1, 5 ′ -TTGCTAAAGCGCTACATAGGA-3 ′ This paper N/A Nestin-Cre Primer 2, 5 ′ -CCTTCCTGAAGCAGTAGAGCA-3 ′ This paper N/A Nestin-Cre Primer 3, 5 ′ -GCCTTATTGTGGAAGGACTG-3 ′ This paper N/A shSTIM1: AGAAGGAGCTAGAATCTCAC This paper N/A shTFR1: CGTTGAATTGAACCTGGACTA This paper N/A ShNC: TTCTCCGAACGTGTCACGT This paper N/A Software and algorithms ChemiDoc MP Imaging System Bio-Rad https://www.bio-rad.com/ ImageJ NIH https://imagej.net/ HDOCK Huang’s Lab, Huazhong University of Science and Technology http://hdock.phys.hust.edu.cn/ PDBePISA EMBL-EBI https://www.ebi.ac.uk/pdbe/pisa/ AutoDock Vina The Scripps Research Institute http://vina.scripps.edu/ Gromacs 2021.5 GROMACS Development Team, KTH Royal Institute of Technology and Uppsala University http://www.gromacs.org/ Biacore Evaluation Software (T200) Cytiva https://www.cytivalifesciences.com/ Schrö dinger Maestro 12.8 Schrö dinger https://www.schrodinger.com/ PyMOL Schrö dinger https://pymol.org/ GraphPad Prism version 10.1.2 GraphPad Software https://www.graphpad.com/ Cell Reports Medicine 7, 102595, February 17, 2026 e3 OPEN ACCESS 3. ..

    Activity Assay:

    Article Title: The Ca 2+ sensor STIM1 promotes neuronal ferroptosis by regulating iron homeostasis to exacerbate brain injury after intracerebral hemorrhage.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER GSH/GSSG ratio detection assay kit Abcam Cat# ab205811 GPX4 activity assay kit Elabscience Cat# E-BC-K883-M Iron Assay Kit Elabscience Cat# E-BC-K772-M Iron Assay Kit Elabscience Cat# E-BC-K880-M Ferrous Iron Assay Kit Elabscience Cat# E-BC-K773-M Ferrous Iron Assay Kit Elabscience Cat# E-BC-K881-M Experimental models: Cell lines Mouse HT22 cell line Procell Cat# CL-0697 Human HEK-293F cell line Thermo Fisher Scientific Cat# R79007 Experimental models: Organisms/strains C57BL/6J mouse Fourth Military Medical University N/A STIM1 flox/flox mouse Shanghai Model Organisms N/A Nestin-Cre +/− mouse Shanghai Model Organisms N/A STIM1 flox/flox /Nestin-Cre +/− mouse Shanghai Model Organisms N/A Oligonucleotides STIM1 flox Primer 1 (Forward), 5 ′ -CAGGTTCAGTGAGACCCTGTC-3 ′ This paper N/A STIM1 flox Primer 2 (Reverse), 5 ′ -GCCCACCAAGATCTCCACAA-3 ′ This paper N/A Nestin-Cre Primer 1, 5 ′ -TTGCTAAAGCGCTACATAGGA-3 ′ This paper N/A Nestin-Cre Primer 2, 5 ′ -CCTTCCTGAAGCAGTAGAGCA-3 ′ This paper N/A Nestin-Cre Primer 3, 5 ′ -GCCTTATTGTGGAAGGACTG-3 ′ This paper N/A shSTIM1: AGAAGGAGCTAGAATCTCAC This paper N/A shTFR1: CGTTGAATTGAACCTGGACTA This paper N/A ShNC: TTCTCCGAACGTGTCACGT This paper N/A Software and algorithms ChemiDoc MP Imaging System Bio-Rad https://www.bio-rad.com/ ImageJ NIH https://imagej.net/ HDOCK Huang’s Lab, Huazhong University of Science and Technology http://hdock.phys.hust.edu.cn/ PDBePISA EMBL-EBI https://www.ebi.ac.uk/pdbe/pisa/ AutoDock Vina The Scripps Research Institute http://vina.scripps.edu/ Gromacs 2021.5 GROMACS Development Team, KTH Royal Institute of Technology and Uppsala University http://www.gromacs.org/ Biacore Evaluation Software (T200) Cytiva https://www.cytivalifesciences.com/ Schrö dinger Maestro 12.8 Schrö dinger https://www.schrodinger.com/ PyMOL Schrö dinger https://pymol.org/ GraphPad Prism version 10.1.2 GraphPad Software https://www.graphpad.com/ Cell Reports Medicine 7, 102595, February 17, 2026 e3 OPEN ACCESS 3. ..

    Iron Assay:

    Article Title: The Ca 2+ sensor STIM1 promotes neuronal ferroptosis by regulating iron homeostasis to exacerbate brain injury after intracerebral hemorrhage.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER GSH/GSSG ratio detection assay kit Abcam Cat# ab205811 GPX4 activity assay kit Elabscience Cat# E-BC-K883-M Iron Assay Kit Elabscience Cat# E-BC-K772-M Iron Assay Kit Elabscience Cat# E-BC-K880-M Ferrous Iron Assay Kit Elabscience Cat# E-BC-K773-M Ferrous Iron Assay Kit Elabscience Cat# E-BC-K881-M Experimental models: Cell lines Mouse HT22 cell line Procell Cat# CL-0697 Human HEK-293F cell line Thermo Fisher Scientific Cat# R79007 Experimental models: Organisms/strains C57BL/6J mouse Fourth Military Medical University N/A STIM1 flox/flox mouse Shanghai Model Organisms N/A Nestin-Cre +/− mouse Shanghai Model Organisms N/A STIM1 flox/flox /Nestin-Cre +/− mouse Shanghai Model Organisms N/A Oligonucleotides STIM1 flox Primer 1 (Forward), 5 ′ -CAGGTTCAGTGAGACCCTGTC-3 ′ This paper N/A STIM1 flox Primer 2 (Reverse), 5 ′ -GCCCACCAAGATCTCCACAA-3 ′ This paper N/A Nestin-Cre Primer 1, 5 ′ -TTGCTAAAGCGCTACATAGGA-3 ′ This paper N/A Nestin-Cre Primer 2, 5 ′ -CCTTCCTGAAGCAGTAGAGCA-3 ′ This paper N/A Nestin-Cre Primer 3, 5 ′ -GCCTTATTGTGGAAGGACTG-3 ′ This paper N/A shSTIM1: AGAAGGAGCTAGAATCTCAC This paper N/A shTFR1: CGTTGAATTGAACCTGGACTA This paper N/A ShNC: TTCTCCGAACGTGTCACGT This paper N/A Software and algorithms ChemiDoc MP Imaging System Bio-Rad https://www.bio-rad.com/ ImageJ NIH https://imagej.net/ HDOCK Huang’s Lab, Huazhong University of Science and Technology http://hdock.phys.hust.edu.cn/ PDBePISA EMBL-EBI https://www.ebi.ac.uk/pdbe/pisa/ AutoDock Vina The Scripps Research Institute http://vina.scripps.edu/ Gromacs 2021.5 GROMACS Development Team, KTH Royal Institute of Technology and Uppsala University http://www.gromacs.org/ Biacore Evaluation Software (T200) Cytiva https://www.cytivalifesciences.com/ Schrö dinger Maestro 12.8 Schrö dinger https://www.schrodinger.com/ PyMOL Schrö dinger https://pymol.org/ GraphPad Prism version 10.1.2 GraphPad Software https://www.graphpad.com/ Cell Reports Medicine 7, 102595, February 17, 2026 e3 OPEN ACCESS 3. ..

    Software:

    Article Title: The Ca 2+ sensor STIM1 promotes neuronal ferroptosis by regulating iron homeostasis to exacerbate brain injury after intracerebral hemorrhage.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER GSH/GSSG ratio detection assay kit Abcam Cat# ab205811 GPX4 activity assay kit Elabscience Cat# E-BC-K883-M Iron Assay Kit Elabscience Cat# E-BC-K772-M Iron Assay Kit Elabscience Cat# E-BC-K880-M Ferrous Iron Assay Kit Elabscience Cat# E-BC-K773-M Ferrous Iron Assay Kit Elabscience Cat# E-BC-K881-M Experimental models: Cell lines Mouse HT22 cell line Procell Cat# CL-0697 Human HEK-293F cell line Thermo Fisher Scientific Cat# R79007 Experimental models: Organisms/strains C57BL/6J mouse Fourth Military Medical University N/A STIM1 flox/flox mouse Shanghai Model Organisms N/A Nestin-Cre +/− mouse Shanghai Model Organisms N/A STIM1 flox/flox /Nestin-Cre +/− mouse Shanghai Model Organisms N/A Oligonucleotides STIM1 flox Primer 1 (Forward), 5 ′ -CAGGTTCAGTGAGACCCTGTC-3 ′ This paper N/A STIM1 flox Primer 2 (Reverse), 5 ′ -GCCCACCAAGATCTCCACAA-3 ′ This paper N/A Nestin-Cre Primer 1, 5 ′ -TTGCTAAAGCGCTACATAGGA-3 ′ This paper N/A Nestin-Cre Primer 2, 5 ′ -CCTTCCTGAAGCAGTAGAGCA-3 ′ This paper N/A Nestin-Cre Primer 3, 5 ′ -GCCTTATTGTGGAAGGACTG-3 ′ This paper N/A shSTIM1: AGAAGGAGCTAGAATCTCAC This paper N/A shTFR1: CGTTGAATTGAACCTGGACTA This paper N/A ShNC: TTCTCCGAACGTGTCACGT This paper N/A Software and algorithms ChemiDoc MP Imaging System Bio-Rad https://www.bio-rad.com/ ImageJ NIH https://imagej.net/ HDOCK Huang’s Lab, Huazhong University of Science and Technology http://hdock.phys.hust.edu.cn/ PDBePISA EMBL-EBI https://www.ebi.ac.uk/pdbe/pisa/ AutoDock Vina The Scripps Research Institute http://vina.scripps.edu/ Gromacs 2021.5 GROMACS Development Team, KTH Royal Institute of Technology and Uppsala University http://www.gromacs.org/ Biacore Evaluation Software (T200) Cytiva https://www.cytivalifesciences.com/ Schrö dinger Maestro 12.8 Schrö dinger https://www.schrodinger.com/ PyMOL Schrö dinger https://pymol.org/ GraphPad Prism version 10.1.2 GraphPad Software https://www.graphpad.com/ Cell Reports Medicine 7, 102595, February 17, 2026 e3 OPEN ACCESS 3. ..

    Article Title: Human conjunctiva organoids to study ocular surface homeostasis and disease.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER BSA MP biomedicals 160069 Triton X-100 Sigma-Aldrich X100-100ML Pertex Klinipath AM-08010 pSpCas9(BB)-2A-GFP gRNA cloning reagents Ran et al.90 N/A BTXpress solution BTX 45-0805 DTT Sigma Aldrich D0632 Lysyl endopeptidase (Lys C) Wako Chemicals GmbH 129-05061 Reversed-phase C18 1cc columns Waters Corporation WAT054925 Trypsin Sigma Aldrich T1426 Fibrin TISSEEL Baxter 1506079 Critical Commercial Assays RNeasy Mini Kit QIAGEN 74104 QIAquick PCR Purification Kit QIAGEN 28104 Quick-DNA Microprep kit Zymogen ZY-D3020 Chromium 3’ Gene Expression solution v3.1 10x Genomics PN-120237 TruSeq Stranded mRNA kit Illumina N/A pJet cloning kit Thermo Fisher scientific K1232 Miniprep DNA isolation kit Thermo Fisher scientific K210003 Midiprep DNA isolation kit Thermo Fisher scientific K210005 Micro BCA Protein Assay Kit Bio-Rad 23235 4-15% Mini-PROTEAN precast protein gel 10-well 30 mL Bio-Rad 4561083 ECL Prime Western blotting detection reagent GE Healthcare Life Sciences RPN2232 Deposited Data Raw and processed mouse conjunctiva bulk mRNA sequencing data This paper GEO: GSE205926 Raw and processed human conjunctiva single-cell mRNA sequencing data This paper GEO: GSE242382 Raw and processed human conjunctiva infected with HSV1 and hAdV8 bulk mRNA sequencing data This paper GEO: GSE205925 Processed human lung single-cell atlas Travaglini et al.91 https://www.synapse.org/ #!Synapse:syn21041850 Processed human gut single-cell atlas: epithelial cells Elmentaite et al.92 https://www.gutcellatlas.org/ Processed human stomach single-cell atlas Kumar et al.93 GEO: GSE183904 Pterygium and healthy conjunctiva bulk mRNA sequencing data Wolf et al.23 GEO: GSE155776 Raw conjunctival secretome data This paper ProteomeXchange: PXD043550 Compiled code used for human single-cell RNA sequencing analysis This paper https://github.com/MarieBannier/ Conjunctiva Seurat objects of human conjunctiva single-cell RNA sequencing This paper Zenodo: 8403667 Experimental Models: Organisms/Strains C57BL/6 mice Hubrecht Institute N/A NOD Scid Gamma (NSG) mice Hubrecht Institute N/A HSV1-tdTomato Etienne et al.52 N/A hAdV8 This paper N/A SARS-CoV-2 (ancestral strain, 614G) EVAg 026V-03883 SARS-CoV-2 (Delta variant) GenBank OM287123 (Continued on next page) e3 Cell Stem Cell 31, 1–17.e1–e12, February 1, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER Oligonucleotides qPCR primers This paper, Bannier-Hélaou€et et al.,81 and Table S7 N/A Viral titer primers This paper, Corman et al.,94 Lõhmussaar et al.,87 Miura-Ochiai et al.,95 and Table S7 N/A Pax6 KO primers Bannier-Hélaou€et et al.81 and Table S7 N/A Software and Algorithms CFX manager software Bio-Rad N/A Seurat v3 and v4 Stuart et al. and Hao et al.96,97 https://satijalab.org/seurat/index.html Samtools v1.10 Li98 http://www.htslib.org/ umi_tools v1.1.1 Smith et al.99 https://github.com/CGATOxford/UMI-tools CellRanger v7.1.0 10x genomics https://support.10xgenomics.com/ single-cell-gene-expression/software/ pipelines/latest/installation Souporcell Heaton et al.100 https://github.com/wheaton5/souporcell DESeq2 v1.26.0 Love et al.101 https://github.com/mikelove/DESeq2 Goseq Young et al.102 https://rdrr.io/github/nadiadavidson/goseq/ clusterProfiler v3.14.0 Yu et al.103 https://github.com/YuLab-SMU/clusterProfiler ChIPpeakAnno v3.20.0 Zhu et al.104 https://rdrr.io/bioc/ChIPpeakAnno/man/ Python Python https://www.python.org/ R version 4.1.0 R Core https://www.r-project.org/ Rstudio Rstudio https://rstudio.com/ MaxQuant v2.4.2.0 MaxQuant https://www.maxquant.org/ Uniprot human database Uniprot https://www.uniprot.org/ Perseus v1.6.15.0 Max Planck Institute of Biochemistry https://maxquant.net/perseus/ GraphPad PRISM 9 GraphPad N/A Las X Leica N/A Adobe illustrator Adobe inc. N/A Fiji NIH, Fiji developers https://imagej.net/Fiji Other EVOS FL Auto 2 Cell Imaging System Thermo Fisher scientific N/A ImageQuant LAS 4000 ECL western blot imager GE Healthcare Life Sciences N/A LSM700 confocal microscope Zeiss N/A SP8 confocal microscope Leica N/A SP8X confocal microscope Leica N/A DM4000 Leica N/A NEPA21 electroporator Nepagene N/A Ultramicrotome Ultracut Leica N/A Tecnai T12 electron microscope Thermo Fisher scientific N/A Eagle 4k*4k CCD camera Thermo Fisher scientific N/A NovaSeq6000 Illumina N/A CFX384 Touch Real-Time PCR detection system Bio-Rad N/A Spark multimode microplate reader Tecan N/A 12-well suspension plates Greiner 665102 24-well suspension plates Greiner 662102 (Continued on next page) Cell Stem Cell 31, 1–17.e1–e12, February 1, 2024 e4 .. REAGENT or RESOURCE SOURCE IDENTIFIER Thincert cell culture insert for 24 well plates Greiner 662630 Orbitrap Eclipse Tribrid Mass Spectrometer Thermo Fisher scientific N/A Vanquish Neo UHPLC System Thermo Fisher scientific N/A Easy-Spray PepMap Neo 2 mm C18 75 mm X 500 mm Thermo Fisher scientific ES75500PN FACSFusion BD Biosciences N/A FACSAria BD Biosciences N/A FACSJazz BD Biosciences N/A

    Article Title: Adipocyte PI3K links adipostasis with baseline insulin secretion at fasting through an adipoincretin effect.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies AKT Phospho (Thr308) Cell Signaling 4056; RRID: AB_331163 AKT Phospho (Ser373) XP Cell Signaling 4060; RRID: AB_2315049 AKT Cell Signaling 9272; RRID: AB_329827 Erk 1/2 (p44/42 MAPK) Phospho(Thr202/Tyr204) XP Cell Signaling 9101; RRID: AB_331646 Erk 1/2 (p44/42 MAPK) Cell Signaling 9102; RRID: AB_330744 IRS1 Millipore 06248; RRID: AB_2127890 IRS2 Millipore MABS15; RRID: AB_1121131 PI3K p85 Cell Signaling 4257; RRID: AB_659889 PI3K p85a Abcam Ab133595 PI3K p55g Abcam Ab238509 Tubulin a/b Cell Signaling 2148; RRID: AB_2288042 PI3Ka Cell Signaling 4249; RRID: AB_2165248 PI3Kb Cell Signaling 3011; RRID: AB_2165246 PI3Kd Millipore 04–401; RRID: AB_673111 PI3Kg a gift of Prof. Matthias Wymann University of Basel (Russian) HSL Phospho (Ser563) Cell Signaling 4139; RRID: AB_2135495 HSL Phospho (Ser660) Cell Signaling 4126; RRID: AB_490997 HSL Phospho (Ser565) Cell Signaling 4137; RRID: AB_2135498 HSL Cell Signaling 4107; RRID: AB_2296900 Chemicals, peptides, and recombinant proteins Insulin Humalog Lilly VL7510 Glucose Acros 410955000 BSA Fisher Scientific BP9702 ECL-anti rabbit IgG HRP GE Healthcare NA934V ECL-anti mouse IgG HRP GE Healthcare LNA931V Collagenase P Roche 11213865001 GSK2636771 (Inhibitor PI3Kb) SelleckChem S8002 TGX-221 (Inhibitor PI3Kb) MedChem Express HY-10114 IPI549 (Inhibitor PI3Kg) MedChem Express(SelleckChem) HY-100716 PIK294 (Inhibitor PI3Kd) MedChem Express HY-10303 Buparlisib (BKM120, panPI3K inhibitor) MedChem Express HY-70063 Taselisib (GDC-0032, panPI3K inhibitor) MedChem Express HY-13898 Nicotinic Acid Sigma 72309 Atglistatin MedChem Express HY-15859 Cremophor EL Millipore 238470 CL 316,243 Sigma C5976 Critical commercial assays Insulin ELISA Kit Crystal Chem 90080 C-peptide Elisa Kit Crystal Chem 90050 FFA (NEFA-HR set) Fuji Film 436-91995, 434-91795 91096 (standard) Leptin Elisa Kit R&D MOB00B (Continued on next page) Cell Reports 43, 114132, May 28, 2024 17 .. REAGENT or RESOURCE SOURCE IDENTIFIER Adipsin Elisa Kit R&D DY5430-05 FABP4 Elisa Kit BioVendor RD191036200R Asprosin Elisa Kit Abbexa abx585287 Adrenaline Elisa Kit LDN BA E 5100R Corticosterone Elisa Kit IDS AC-14F1 Glucagon Elisa Kit Crystal Chem 81518 Mouse Growth factor Elisa Kit Crystal Chem 80587 Glycerol Assay Kit Sigma-Aldrich MAK117 b-Hydroxybutyrate Assay Kit Sigma-Aldrich MAK041 Immobilon Western Chemiluminescence HRP substrate Millipore WBKLS0500 Hematoxylin Solution (Mayer’s, Modified) Abcam AB220365 Eosin Sigma HT110116 Deposited data Immunoblots images This paper https://doi.org/10.17632/tgsgkjz28w.1 Experimental models: Organisms/strains WT C57BL/6 background Janvier Labs PI3KaF/F Mixed background Provided by Victoria Rotter Sopasakis PI3KaAdQ Mixed background Provided by Victoria Rotter Sopasakis Software and algorithms Image Lab software (version 5.2.1) Bio-Rad http://www.bio-rad.com/en-us/ product/image-lab-software Graph Pad Prism 7.0 Graph Pad Software N/A AxioVision Software Imaging Sofware Carl Zeiss Microscopy ..

    Article Title: Multi-dimensional metabolomic remodeling under diverse muscle atrophic stimuli in vivo.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER TSKgel Amide-80 (3.0 μm, 2.0 mm × 15 cm TOSOH Corporation Cat# 0021865 G266 DNA Damage Detection Kit - γH2AX - Red Dojindo Molecular Technologies Cat# 340-09431 HEPES Nacalai Tesque Cat# 02443-34 Trichloroacetic acid Nacalai Tesque Cat# 06275-24 L-Methionine sulfome Thermo Fisher Cat# A17027 Takara Taq Takara Cat# R001A Takara Ex Taq Takara Cat# RR001A Agarose for ≧1kbp fragment (Fine Powder) Nacalai Tesque Cat# 02468-95 100 bp DNA ladder One Nacalai Tesque Cat# 07908-75 6x Loading Dye Toyobo Cat# RE-DYE Ethidium Bromide Solution Nacalai Tesque Cat# 14631-94 Sodium Chloride Nacalai Tesque Cat# 31320-05 Bacto TM Peptone DIFCO Cat# 0118-17-0 Extract Yeast Dried Nacalai Tesque Cat# 15838-45 Bacto TM Agar BD Cat# 214010 Competent Quick DH5α Toyobo Cat# DNA-913 Ampicillin Sodium Salt Nacalai Tesque Cat# 02739-74 KOD-Plus-Neo Toyobo Cat# KOD-401 QIAGEN Plasmid Midi kit QIAGEN Cat# 12145 Calf intestine alkarine phosphatase Takara Cat# 2250A QIAEX II Gel Extraction Kit QIAGEN Cat# 20021 DNA Ligation Kit Ver.2.1 Takara Cat# 6022 Venoject II Terumo Cat# VP-DK051K Isoflurane Viatris – Domitor Nippon Zenyaku Kogyo – Midazolam Sandoz – Vetorphale Meiji Seika Pharma – Antisedan Nippon Zenyaku Kogyo – Deposited data Metabolomics data (Skeletal muscle, FoxO1 overexpression and immobilization, FoxO1-Tg and C57BL/6J) https://www. metabolomicsworkbench.org Metabolomics Workbench Study ID: ST003721; Project ID: PR002310 Metabolomics data (plasma, FoxO1 overexpression and immobilization, FoxO1-Tg and C57BL/6J) https://www. metabolomicsworkbench.org Metabolomics Workbench Study ID: ST003722; Project ID: PR002311 Metabolomics data (Skeletal muscle, Cancer cachexia and starvation, C57BL/6J) https://www. metabolomicsworkbench.org Metabolomics Workbench Study ID: ST003723; Project ID: PR002312 Metabolomics data (Skeletal muscle, immobilization, mFoxO1,3,4 flox/flox and mFoxO1,3,4 − /− ) https://www. metabolomicsworkbench.org Metabolomics Workbench Study ID: ST003724; Project ID: PR002313 Experimental models: Cell lines LLC cells: LL/2 (LLC1) ATCC CRL-1642 Primary myoblast This paper N/A C2C12 myoblasts Riken Cell Bank RCB0987 C2C12 myoblasts (Western blot analysis for SUnSET analysis and MG-132 experiment) ATCC CRL-1772 HEK293T cells Oyabu et al. 29 N/A Experimental models: Organisms/strains Mouse: C57BL/6J CLEA – Mouse: HSA-FOXO1-Tg Kamei Lab N/A Mouse: HSA-Cre FoxO1,3,4 flox/flox Kamei Lab N/A Mouse: HSA-DN-FOXO1-Tg Yamazaki et al. 42 N/A (Continued on next page) Cell Reports 44, 116097, August 26, 2025 19 .. REAGENT or RESOURCE SOURCE IDENTIFIER Oligonucleotides Primers for genotyping This paper Table S1 Primer for RT-qPCR This paper Table S2 MISSION siRNA Universal Negative Control #1 Sigma-Aldrich Cat# SIC001 MISSION siAmd2_1 Sigma-Aldrich Cat# SASI_Mm02_00311615 MISSION siAmd2_2 Sigma-Aldrich Cat# SASI_Mm01_00156378 Recombinant DNA pCAG-FOXO1(3A) Oyabu et al. 29 N/A pCMX-GFP Oyabu et al. 29 N/A pGL3-Odc1 promoter-luciferase This paper N/A phRL-TK Promega Cat# E2241 Software and algorithms Prism 10 software GraphPad Software – ImageJ NIH https://imagej.nih.gov/ij/download.html BZ-X800 Viewer Keyence – BZ-X800 Analyzer Keyence – ImageLab software Bio-Rad – Venn Diagrams Bioinformatics & Evolutionary Genomics http://bioinformatics.psb.ugent.be/ webtools/Venn/ Cluster 3.0 de Hoon et al. 43 http://bonsai.hgc.jp/∼mdehoon/ software/cluster/ Java TreeView Saldanha et al. 44 https://jtreeview.sourceforge.net MasterHands ver.2 software (Keio University, Tsuruoka, Yamagata, Japan) Sugimoto t al. 45 N/A MetaboAnalyst Pang et al. 46 https://www.metaboanalyst.ca/ LabSolutions LCMS Shimadzu N/A RNAseqChef Etoh and Nakao 47 https://imeg-ku.shinyapps.io/RNAseqChef/ GREIN: GEO RNA-seq Experiments Interactive Navigator Mahi et al. 48 https://www.ilincs.org/apps/grein/ SarcoAtlas Ham et al. 49 and Borsch et al. 50 https://sarcoatlas.scicore.unibas.ch Ensembl Harrison et al. 51 https://asia.ensembl.org Clustal Omega Multiple sequence Alighment (MSA) Madeira et al. 52 https://www.ebi.ac.uk/ jdispatcher/msa/clustalo R system R Core Team https://cran.r-project.org Programming environment of R: RStudio RStudio Team https://www.rstudio.com Adobe Illustrator Adobe https://www.adobe.com Excel Microsoft https://www.microsoft.com/ en-us/microsoft-365/excel BioRender: Scientific Image and Illustration Software N/A https://www.biorender.com Primer Express 2.0 Thermo Fisher – Primer-BLAST NIH https://www.ncbi.nlm.nih.gov/tools/primer- blast/https://www.ilincs.org/apps/grein/ Other Metabolomic analyses (CE-TOFMS) Human Metabolome Technologies N/A Agilent CE-TOFMS system Agilent Technologies – LCMS-8040 triple quadrupole mass spectrometer Shimadzu – Grip strength meter Melquest Cat# GPM-101B CFX Connect Real-Time PCR Detection System Bio-Rad Cat# 1855201J1 ChemiDoc XRS+ Imaging System Bio-Rad Cat# 1708265J1 (Continued on next page) 20 Cell Reports 44, 116097, August 26, 2025 ..

    Article Title: The phosphodiesterase 2A controls lymphatic junctional maturation via cGMP-dependent notch signaling.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Experimental models: Cell lines HDLECs PromoCell Cat# C-12216 HUVECs PromoCell Cat# C-12203 mECs This manuscript N/A Experimental models: Organisms/strains Mouse: Tie2-Cre (B6.Cg-Tg(Tek-cre) 1Ywa/J) Kisanuki et al.69 RRID:IMSR_JAX:008863 Mouse: Cdh5-CreERT2 (Tg(Cdh5-cre/ ERT2)1Rha) Sörensen et al.70 RRID:IMSR_EM:14891 Mouse: Prox1-CreERT2 (Tg(Prox1-cre/ ERT2)1Tmak Bazigou et al.71 RRID:IMSR_EM:13737 Mouse: Pde2a global knockout (B6; 129P2487Pde2A < tm1Dgen>/H; EM: 02366) Assenza et al.25 RRID:IMSR_EM:02366 Mouse: Pde2a (Pde2atm1a(EUCOMM)Wtsl) This manuscript N/A Oligonucleotides AllStars Negative CTRL siRNA Qiagen Cat# 1027281 FlexiTube PDE2A siRNA Qiagen Cat# SI00040159 DLL1 (hs00194509_m1) Thermo Fischer Scientific Cat# 4331182 GAPDH (hs99999905) Thermo Fischer Scientific Cat# 4326317E Gapdh (mm99999915_g1) Thermo Fischer Scientific Cat# 4352932E GJA4 (hs00704917_s1) Thermo Fischer Scientific Cat# 4331182 Hey1 (mm00468865_m1) Thermo Fischer Scientific Cat# 4331182 miR-139-5p (MI0000693) Thermo Fischer Scientific Cat# 002289 Mki67 (mm01278617_m1) Thermo Fischer Scientific Cat# 4331182 PDE10A (hs01098928_m1) Thermo Fischer Scientific Cat# 4351372 PDE12 (hs00698272_m1) Thermo Fischer Scientific Cat# 4331182 PDE2A (hs00159935_m1) Thermo Fischer Scientific Cat# 4331182 Pde2a (mm01136644_m1) Thermo Fischer Scientific Cat# 4331182 PDE3A (hs01012698_m1) Thermo Fischer Scientific Cat# 4331182 PDE4B (hs00963643_m1) Thermo Fischer Scientific Cat# 4331182 PDE4D (hs01579625_m1) Thermo Fischer Scientific Cat# 4331182 PDE6D (hs01062025_m1) Thermo Fischer Scientific Cat# 4331182 PDE8A (hs01079617_m1) Thermo Fischer Scientific Cat# 4331182 PSEN2 (hs01577197_m1) Thermo Fischer Scientific Cat# 4331182 RNU48 (TaqMan MicroRNA Assay) Thermo Fischer Scientific Cat# 001006 snoRNA202 (TaqMan MicroRNA Assay) Thermo Fischer Scientific Cat# 001232 snoRNA234 (TaqMan MicroRNA Assay) Thermo Fischer Scientific Cat# 001234 Pde2a-5’-arm 50ACTGGTCAGTTCTGAGC CTCACCC 30 This paper N/A Pde2a-3’-arm 50 AGTCTGGACTCCCCA TCTAGCAGG 30 This paper N/A Cre transgene sense 50GAACCTGATGG ACATGTTCAGG 30 This paper N/A Cre transgene antisense 50 AGTGCGTT CGAACGCTAGAGCCTGT 30 This paper N/A Myogenin sense 50 TTACGTCCA TCGTGGACAGC 30 This paper N/A Myogenin antisense 50 TGGGCTGGGT GTTAGCCTTA 30 This paper N/A (Continued on next page) e4 Developmental Cell 59, 1–18.e1–e11, February 5, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER Software and algorithms BioRad Image Lab Software BioRad N/A Diva 8.0.1 software BD Biosciences N/A Fiji ImageJ N/A https://imagej.net/ij/ GraphPad Prism 9 Dotmatics N/A Leica LAS-X software Leica N/A MicroManager 1.4 software Open source N/A Seurat package Satija et al.72 https://www.nature.com/articles/nbt.3192 umap package McInnes et al.73 https://joss.theoj.org/papers/10.21105/ joss.00861 Plotly software Open source https://plotly.com/r/ FastQC (v0.11.9) Open source http://www.bioinformatics.babraham.ac. uk/projects/fastqc/ Trimmomatic (v0.36) Bolger et al.74 https://academic.oup.com/bioinformatics/ article/30/15/2114/2390096?login=true STAR (v2.7.3a) Dobin et al.75 https://academic.oup.com/bioinformatics/ article/29/1/15/272537 ComBat-seq Zhang et al.76 https://academic.oup.com/nargab/article/ 2/3/lqaa078/5909519?searchresult=1 WebGestalt platform 2019 Liao et al.77 https://academic.oup.com/nar/article/47/ W1/W199/5494758?login=true Other 24-well Plate Softwell Easy Coat hydrogels (0.1, 1, 2, 4 and 25kPa) Matrigen Cat# SS24-EC 8-well Lab-Tek II chamber slides Lab-Tek Cat# 154941 Agilent Technologies 2100 bioanalyzer Agilent https://www.agilent.com/en/product/ automated-electrophoresis/bioanalyzersystems/bioanalyzer-instrument AMPure XP magnetic beads Beckman Cat# A53880 Axiocam 208 Color Zeiss N/A BD Biosciences FACSAria IIIu BD Biosciences N/A CoolLED beam-splitter DV2 Dual View Photometrics N/A CMOS camera chip OptiMOS, Qimaging N/A DEAE-Sephadex A-25 columns Cytiva Cat# 17017001 DynaMag -2 Invitrogen Cat# 12321D Gel Doc MP Imaging System BioRad N/A Hamilton TLC syringe Sigma-Aldrich Cat# HAM7635-01-1EA Immobilion -P Transfer Membrane (0.45mm pore size) Merck Cat# IPVH00010 Inject -F syringe Braun Cat# 9166017V Leica DMI 3000 B inverted fluorescent microscope Leica N/A Leica SP8 inverted microscope Leica N/A Nikon Eclipse Ts2R microscope Nikon N/A Sheep-anti-rat IgG Dynabeads Invitrogen Cat# 110-35 StepOnePlus RT PCR system Applied Biosystems N/A Tecan Spark 10M microplate reader Tecan N/A Tissue culture-treated dishes Corning Cat# 430167 Tissue culture-treated dishes (60mm) Corning Cat# 430166 Transwell filters (0.4mm pore size) Corning Cat# 3413 (Continued on next page) Developmental Cell 59, 1–18.e1–e11, February 5, 2024 e5 .. REAGENT or RESOURCE SOURCE IDENTIFIER Tri-Carb 2100TR Liquid Scintillation Counter Packard Instruments Cat# 2000CA ULTIMA GOLD scintillation liquid PerkinElmer Cat# 6013326 UltraComp eBeads Plus Compensation Beads Invitrogen Cat# 01-3333-42 Zeiss Stemi 508 Zeiss N/A

    Article Title: Reversal of diet-induced obesity by central insulin sensitizer FSTL1.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Experimental models: Organisms/strains Mouse: C57BL/6J The GemPharmatech N000013 Mouse: db/db The GemPharmatech T002407 Mouse: ob/ob The GemPharmatech T001461 Mouse: AgRP-Cre Gift from Prof. Shu 61 N/A Mouse: Rosa26-tdTomato Gift from Prof. Guo 62 N/A Mouse: Fstl1 fl/fl Gift from Prof. Ning 63 N/A Oligonucleotides Pomc: Forward: CCTTGGCTAGATAACGAACTCTG Merck N/A Pomc: Reverse: AGATGACGTGGCAAAGAACAG Merck N/A Agrp: Forward: CCTCGTCGAACTCTATTCCCAG Merck N/A Agrp: Reverse: ACCAAGCCTACTACCATCATCG Merck N/A Npy: Forward: TAGGAGTAGTGCCCAAATGC Merck N/A Npy: Reverse: AAGAGCCTGGTCAAGTTCTG Merck N/A β-actin: Forward: CAGTGTCCATCCTCTGAGTAGC Merck N/A β-actin: Reverse: GGCATAAACGCAGAGCATTCCTG Merck N/A Software and algorithms ChemiDoc Imaging System BioRad RRID: SCR_014210 GraphPad Prism 9.1.0 Prism RRID:SCR_002798 Fiji NIH https://imagej.net/Fiji/Downloads SPSS IBM http://www.spss.com.cn/ Leica Application Suite Leica Microsystems https://www.leica-microsystems.com/ products/microscope-software/p/ leicalas-x-ls/ Biorender Biorender.com https://www.biorender.com/ e2 Neuron 114, 1–20.e1–e5, January 7, 2026 .. Eight-week-old male C57BL/6J mice and db/db and ob/ob mice were purchased from GemPharmatech Co., Ltd. (Nanjing, China).

    Imaging:

    Article Title: The Ca 2+ sensor STIM1 promotes neuronal ferroptosis by regulating iron homeostasis to exacerbate brain injury after intracerebral hemorrhage.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER GSH/GSSG ratio detection assay kit Abcam Cat# ab205811 GPX4 activity assay kit Elabscience Cat# E-BC-K883-M Iron Assay Kit Elabscience Cat# E-BC-K772-M Iron Assay Kit Elabscience Cat# E-BC-K880-M Ferrous Iron Assay Kit Elabscience Cat# E-BC-K773-M Ferrous Iron Assay Kit Elabscience Cat# E-BC-K881-M Experimental models: Cell lines Mouse HT22 cell line Procell Cat# CL-0697 Human HEK-293F cell line Thermo Fisher Scientific Cat# R79007 Experimental models: Organisms/strains C57BL/6J mouse Fourth Military Medical University N/A STIM1 flox/flox mouse Shanghai Model Organisms N/A Nestin-Cre +/− mouse Shanghai Model Organisms N/A STIM1 flox/flox /Nestin-Cre +/− mouse Shanghai Model Organisms N/A Oligonucleotides STIM1 flox Primer 1 (Forward), 5 ′ -CAGGTTCAGTGAGACCCTGTC-3 ′ This paper N/A STIM1 flox Primer 2 (Reverse), 5 ′ -GCCCACCAAGATCTCCACAA-3 ′ This paper N/A Nestin-Cre Primer 1, 5 ′ -TTGCTAAAGCGCTACATAGGA-3 ′ This paper N/A Nestin-Cre Primer 2, 5 ′ -CCTTCCTGAAGCAGTAGAGCA-3 ′ This paper N/A Nestin-Cre Primer 3, 5 ′ -GCCTTATTGTGGAAGGACTG-3 ′ This paper N/A shSTIM1: AGAAGGAGCTAGAATCTCAC This paper N/A shTFR1: CGTTGAATTGAACCTGGACTA This paper N/A ShNC: TTCTCCGAACGTGTCACGT This paper N/A Software and algorithms ChemiDoc MP Imaging System Bio-Rad https://www.bio-rad.com/ ImageJ NIH https://imagej.net/ HDOCK Huang’s Lab, Huazhong University of Science and Technology http://hdock.phys.hust.edu.cn/ PDBePISA EMBL-EBI https://www.ebi.ac.uk/pdbe/pisa/ AutoDock Vina The Scripps Research Institute http://vina.scripps.edu/ Gromacs 2021.5 GROMACS Development Team, KTH Royal Institute of Technology and Uppsala University http://www.gromacs.org/ Biacore Evaluation Software (T200) Cytiva https://www.cytivalifesciences.com/ Schrö dinger Maestro 12.8 Schrö dinger https://www.schrodinger.com/ PyMOL Schrö dinger https://pymol.org/ GraphPad Prism version 10.1.2 GraphPad Software https://www.graphpad.com/ Cell Reports Medicine 7, 102595, February 17, 2026 e3 OPEN ACCESS 3. ..

    Article Title: Human conjunctiva organoids to study ocular surface homeostasis and disease.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER BSA MP biomedicals 160069 Triton X-100 Sigma-Aldrich X100-100ML Pertex Klinipath AM-08010 pSpCas9(BB)-2A-GFP gRNA cloning reagents Ran et al.90 N/A BTXpress solution BTX 45-0805 DTT Sigma Aldrich D0632 Lysyl endopeptidase (Lys C) Wako Chemicals GmbH 129-05061 Reversed-phase C18 1cc columns Waters Corporation WAT054925 Trypsin Sigma Aldrich T1426 Fibrin TISSEEL Baxter 1506079 Critical Commercial Assays RNeasy Mini Kit QIAGEN 74104 QIAquick PCR Purification Kit QIAGEN 28104 Quick-DNA Microprep kit Zymogen ZY-D3020 Chromium 3’ Gene Expression solution v3.1 10x Genomics PN-120237 TruSeq Stranded mRNA kit Illumina N/A pJet cloning kit Thermo Fisher scientific K1232 Miniprep DNA isolation kit Thermo Fisher scientific K210003 Midiprep DNA isolation kit Thermo Fisher scientific K210005 Micro BCA Protein Assay Kit Bio-Rad 23235 4-15% Mini-PROTEAN precast protein gel 10-well 30 mL Bio-Rad 4561083 ECL Prime Western blotting detection reagent GE Healthcare Life Sciences RPN2232 Deposited Data Raw and processed mouse conjunctiva bulk mRNA sequencing data This paper GEO: GSE205926 Raw and processed human conjunctiva single-cell mRNA sequencing data This paper GEO: GSE242382 Raw and processed human conjunctiva infected with HSV1 and hAdV8 bulk mRNA sequencing data This paper GEO: GSE205925 Processed human lung single-cell atlas Travaglini et al.91 https://www.synapse.org/ #!Synapse:syn21041850 Processed human gut single-cell atlas: epithelial cells Elmentaite et al.92 https://www.gutcellatlas.org/ Processed human stomach single-cell atlas Kumar et al.93 GEO: GSE183904 Pterygium and healthy conjunctiva bulk mRNA sequencing data Wolf et al.23 GEO: GSE155776 Raw conjunctival secretome data This paper ProteomeXchange: PXD043550 Compiled code used for human single-cell RNA sequencing analysis This paper https://github.com/MarieBannier/ Conjunctiva Seurat objects of human conjunctiva single-cell RNA sequencing This paper Zenodo: 8403667 Experimental Models: Organisms/Strains C57BL/6 mice Hubrecht Institute N/A NOD Scid Gamma (NSG) mice Hubrecht Institute N/A HSV1-tdTomato Etienne et al.52 N/A hAdV8 This paper N/A SARS-CoV-2 (ancestral strain, 614G) EVAg 026V-03883 SARS-CoV-2 (Delta variant) GenBank OM287123 (Continued on next page) e3 Cell Stem Cell 31, 1–17.e1–e12, February 1, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER Oligonucleotides qPCR primers This paper, Bannier-Hélaou€et et al.,81 and Table S7 N/A Viral titer primers This paper, Corman et al.,94 Lõhmussaar et al.,87 Miura-Ochiai et al.,95 and Table S7 N/A Pax6 KO primers Bannier-Hélaou€et et al.81 and Table S7 N/A Software and Algorithms CFX manager software Bio-Rad N/A Seurat v3 and v4 Stuart et al. and Hao et al.96,97 https://satijalab.org/seurat/index.html Samtools v1.10 Li98 http://www.htslib.org/ umi_tools v1.1.1 Smith et al.99 https://github.com/CGATOxford/UMI-tools CellRanger v7.1.0 10x genomics https://support.10xgenomics.com/ single-cell-gene-expression/software/ pipelines/latest/installation Souporcell Heaton et al.100 https://github.com/wheaton5/souporcell DESeq2 v1.26.0 Love et al.101 https://github.com/mikelove/DESeq2 Goseq Young et al.102 https://rdrr.io/github/nadiadavidson/goseq/ clusterProfiler v3.14.0 Yu et al.103 https://github.com/YuLab-SMU/clusterProfiler ChIPpeakAnno v3.20.0 Zhu et al.104 https://rdrr.io/bioc/ChIPpeakAnno/man/ Python Python https://www.python.org/ R version 4.1.0 R Core https://www.r-project.org/ Rstudio Rstudio https://rstudio.com/ MaxQuant v2.4.2.0 MaxQuant https://www.maxquant.org/ Uniprot human database Uniprot https://www.uniprot.org/ Perseus v1.6.15.0 Max Planck Institute of Biochemistry https://maxquant.net/perseus/ GraphPad PRISM 9 GraphPad N/A Las X Leica N/A Adobe illustrator Adobe inc. N/A Fiji NIH, Fiji developers https://imagej.net/Fiji Other EVOS FL Auto 2 Cell Imaging System Thermo Fisher scientific N/A ImageQuant LAS 4000 ECL western blot imager GE Healthcare Life Sciences N/A LSM700 confocal microscope Zeiss N/A SP8 confocal microscope Leica N/A SP8X confocal microscope Leica N/A DM4000 Leica N/A NEPA21 electroporator Nepagene N/A Ultramicrotome Ultracut Leica N/A Tecnai T12 electron microscope Thermo Fisher scientific N/A Eagle 4k*4k CCD camera Thermo Fisher scientific N/A NovaSeq6000 Illumina N/A CFX384 Touch Real-Time PCR detection system Bio-Rad N/A Spark multimode microplate reader Tecan N/A 12-well suspension plates Greiner 665102 24-well suspension plates Greiner 662102 (Continued on next page) Cell Stem Cell 31, 1–17.e1–e12, February 1, 2024 e4 .. REAGENT or RESOURCE SOURCE IDENTIFIER Thincert cell culture insert for 24 well plates Greiner 662630 Orbitrap Eclipse Tribrid Mass Spectrometer Thermo Fisher scientific N/A Vanquish Neo UHPLC System Thermo Fisher scientific N/A Easy-Spray PepMap Neo 2 mm C18 75 mm X 500 mm Thermo Fisher scientific ES75500PN FACSFusion BD Biosciences N/A FACSAria BD Biosciences N/A FACSJazz BD Biosciences N/A

    Article Title: Adipocyte PI3K links adipostasis with baseline insulin secretion at fasting through an adipoincretin effect.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies AKT Phospho (Thr308) Cell Signaling 4056; RRID: AB_331163 AKT Phospho (Ser373) XP Cell Signaling 4060; RRID: AB_2315049 AKT Cell Signaling 9272; RRID: AB_329827 Erk 1/2 (p44/42 MAPK) Phospho(Thr202/Tyr204) XP Cell Signaling 9101; RRID: AB_331646 Erk 1/2 (p44/42 MAPK) Cell Signaling 9102; RRID: AB_330744 IRS1 Millipore 06248; RRID: AB_2127890 IRS2 Millipore MABS15; RRID: AB_1121131 PI3K p85 Cell Signaling 4257; RRID: AB_659889 PI3K p85a Abcam Ab133595 PI3K p55g Abcam Ab238509 Tubulin a/b Cell Signaling 2148; RRID: AB_2288042 PI3Ka Cell Signaling 4249; RRID: AB_2165248 PI3Kb Cell Signaling 3011; RRID: AB_2165246 PI3Kd Millipore 04–401; RRID: AB_673111 PI3Kg a gift of Prof. Matthias Wymann University of Basel (Russian) HSL Phospho (Ser563) Cell Signaling 4139; RRID: AB_2135495 HSL Phospho (Ser660) Cell Signaling 4126; RRID: AB_490997 HSL Phospho (Ser565) Cell Signaling 4137; RRID: AB_2135498 HSL Cell Signaling 4107; RRID: AB_2296900 Chemicals, peptides, and recombinant proteins Insulin Humalog Lilly VL7510 Glucose Acros 410955000 BSA Fisher Scientific BP9702 ECL-anti rabbit IgG HRP GE Healthcare NA934V ECL-anti mouse IgG HRP GE Healthcare LNA931V Collagenase P Roche 11213865001 GSK2636771 (Inhibitor PI3Kb) SelleckChem S8002 TGX-221 (Inhibitor PI3Kb) MedChem Express HY-10114 IPI549 (Inhibitor PI3Kg) MedChem Express(SelleckChem) HY-100716 PIK294 (Inhibitor PI3Kd) MedChem Express HY-10303 Buparlisib (BKM120, panPI3K inhibitor) MedChem Express HY-70063 Taselisib (GDC-0032, panPI3K inhibitor) MedChem Express HY-13898 Nicotinic Acid Sigma 72309 Atglistatin MedChem Express HY-15859 Cremophor EL Millipore 238470 CL 316,243 Sigma C5976 Critical commercial assays Insulin ELISA Kit Crystal Chem 90080 C-peptide Elisa Kit Crystal Chem 90050 FFA (NEFA-HR set) Fuji Film 436-91995, 434-91795 91096 (standard) Leptin Elisa Kit R&D MOB00B (Continued on next page) Cell Reports 43, 114132, May 28, 2024 17 .. REAGENT or RESOURCE SOURCE IDENTIFIER Adipsin Elisa Kit R&D DY5430-05 FABP4 Elisa Kit BioVendor RD191036200R Asprosin Elisa Kit Abbexa abx585287 Adrenaline Elisa Kit LDN BA E 5100R Corticosterone Elisa Kit IDS AC-14F1 Glucagon Elisa Kit Crystal Chem 81518 Mouse Growth factor Elisa Kit Crystal Chem 80587 Glycerol Assay Kit Sigma-Aldrich MAK117 b-Hydroxybutyrate Assay Kit Sigma-Aldrich MAK041 Immobilon Western Chemiluminescence HRP substrate Millipore WBKLS0500 Hematoxylin Solution (Mayer’s, Modified) Abcam AB220365 Eosin Sigma HT110116 Deposited data Immunoblots images This paper https://doi.org/10.17632/tgsgkjz28w.1 Experimental models: Organisms/strains WT C57BL/6 background Janvier Labs PI3KaF/F Mixed background Provided by Victoria Rotter Sopasakis PI3KaAdQ Mixed background Provided by Victoria Rotter Sopasakis Software and algorithms Image Lab software (version 5.2.1) Bio-Rad http://www.bio-rad.com/en-us/ product/image-lab-software Graph Pad Prism 7.0 Graph Pad Software N/A AxioVision Software Imaging Sofware Carl Zeiss Microscopy ..

    Article Title: Multi-dimensional metabolomic remodeling under diverse muscle atrophic stimuli in vivo.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER TSKgel Amide-80 (3.0 μm, 2.0 mm × 15 cm TOSOH Corporation Cat# 0021865 G266 DNA Damage Detection Kit - γH2AX - Red Dojindo Molecular Technologies Cat# 340-09431 HEPES Nacalai Tesque Cat# 02443-34 Trichloroacetic acid Nacalai Tesque Cat# 06275-24 L-Methionine sulfome Thermo Fisher Cat# A17027 Takara Taq Takara Cat# R001A Takara Ex Taq Takara Cat# RR001A Agarose for ≧1kbp fragment (Fine Powder) Nacalai Tesque Cat# 02468-95 100 bp DNA ladder One Nacalai Tesque Cat# 07908-75 6x Loading Dye Toyobo Cat# RE-DYE Ethidium Bromide Solution Nacalai Tesque Cat# 14631-94 Sodium Chloride Nacalai Tesque Cat# 31320-05 Bacto TM Peptone DIFCO Cat# 0118-17-0 Extract Yeast Dried Nacalai Tesque Cat# 15838-45 Bacto TM Agar BD Cat# 214010 Competent Quick DH5α Toyobo Cat# DNA-913 Ampicillin Sodium Salt Nacalai Tesque Cat# 02739-74 KOD-Plus-Neo Toyobo Cat# KOD-401 QIAGEN Plasmid Midi kit QIAGEN Cat# 12145 Calf intestine alkarine phosphatase Takara Cat# 2250A QIAEX II Gel Extraction Kit QIAGEN Cat# 20021 DNA Ligation Kit Ver.2.1 Takara Cat# 6022 Venoject II Terumo Cat# VP-DK051K Isoflurane Viatris – Domitor Nippon Zenyaku Kogyo – Midazolam Sandoz – Vetorphale Meiji Seika Pharma – Antisedan Nippon Zenyaku Kogyo – Deposited data Metabolomics data (Skeletal muscle, FoxO1 overexpression and immobilization, FoxO1-Tg and C57BL/6J) https://www. metabolomicsworkbench.org Metabolomics Workbench Study ID: ST003721; Project ID: PR002310 Metabolomics data (plasma, FoxO1 overexpression and immobilization, FoxO1-Tg and C57BL/6J) https://www. metabolomicsworkbench.org Metabolomics Workbench Study ID: ST003722; Project ID: PR002311 Metabolomics data (Skeletal muscle, Cancer cachexia and starvation, C57BL/6J) https://www. metabolomicsworkbench.org Metabolomics Workbench Study ID: ST003723; Project ID: PR002312 Metabolomics data (Skeletal muscle, immobilization, mFoxO1,3,4 flox/flox and mFoxO1,3,4 − /− ) https://www. metabolomicsworkbench.org Metabolomics Workbench Study ID: ST003724; Project ID: PR002313 Experimental models: Cell lines LLC cells: LL/2 (LLC1) ATCC CRL-1642 Primary myoblast This paper N/A C2C12 myoblasts Riken Cell Bank RCB0987 C2C12 myoblasts (Western blot analysis for SUnSET analysis and MG-132 experiment) ATCC CRL-1772 HEK293T cells Oyabu et al. 29 N/A Experimental models: Organisms/strains Mouse: C57BL/6J CLEA – Mouse: HSA-FOXO1-Tg Kamei Lab N/A Mouse: HSA-Cre FoxO1,3,4 flox/flox Kamei Lab N/A Mouse: HSA-DN-FOXO1-Tg Yamazaki et al. 42 N/A (Continued on next page) Cell Reports 44, 116097, August 26, 2025 19 .. REAGENT or RESOURCE SOURCE IDENTIFIER Oligonucleotides Primers for genotyping This paper Table S1 Primer for RT-qPCR This paper Table S2 MISSION siRNA Universal Negative Control #1 Sigma-Aldrich Cat# SIC001 MISSION siAmd2_1 Sigma-Aldrich Cat# SASI_Mm02_00311615 MISSION siAmd2_2 Sigma-Aldrich Cat# SASI_Mm01_00156378 Recombinant DNA pCAG-FOXO1(3A) Oyabu et al. 29 N/A pCMX-GFP Oyabu et al. 29 N/A pGL3-Odc1 promoter-luciferase This paper N/A phRL-TK Promega Cat# E2241 Software and algorithms Prism 10 software GraphPad Software – ImageJ NIH https://imagej.nih.gov/ij/download.html BZ-X800 Viewer Keyence – BZ-X800 Analyzer Keyence – ImageLab software Bio-Rad – Venn Diagrams Bioinformatics & Evolutionary Genomics http://bioinformatics.psb.ugent.be/ webtools/Venn/ Cluster 3.0 de Hoon et al. 43 http://bonsai.hgc.jp/∼mdehoon/ software/cluster/ Java TreeView Saldanha et al. 44 https://jtreeview.sourceforge.net MasterHands ver.2 software (Keio University, Tsuruoka, Yamagata, Japan) Sugimoto t al. 45 N/A MetaboAnalyst Pang et al. 46 https://www.metaboanalyst.ca/ LabSolutions LCMS Shimadzu N/A RNAseqChef Etoh and Nakao 47 https://imeg-ku.shinyapps.io/RNAseqChef/ GREIN: GEO RNA-seq Experiments Interactive Navigator Mahi et al. 48 https://www.ilincs.org/apps/grein/ SarcoAtlas Ham et al. 49 and Borsch et al. 50 https://sarcoatlas.scicore.unibas.ch Ensembl Harrison et al. 51 https://asia.ensembl.org Clustal Omega Multiple sequence Alighment (MSA) Madeira et al. 52 https://www.ebi.ac.uk/ jdispatcher/msa/clustalo R system R Core Team https://cran.r-project.org Programming environment of R: RStudio RStudio Team https://www.rstudio.com Adobe Illustrator Adobe https://www.adobe.com Excel Microsoft https://www.microsoft.com/ en-us/microsoft-365/excel BioRender: Scientific Image and Illustration Software N/A https://www.biorender.com Primer Express 2.0 Thermo Fisher – Primer-BLAST NIH https://www.ncbi.nlm.nih.gov/tools/primer- blast/https://www.ilincs.org/apps/grein/ Other Metabolomic analyses (CE-TOFMS) Human Metabolome Technologies N/A Agilent CE-TOFMS system Agilent Technologies – LCMS-8040 triple quadrupole mass spectrometer Shimadzu – Grip strength meter Melquest Cat# GPM-101B CFX Connect Real-Time PCR Detection System Bio-Rad Cat# 1855201J1 ChemiDoc XRS+ Imaging System Bio-Rad Cat# 1708265J1 (Continued on next page) 20 Cell Reports 44, 116097, August 26, 2025 ..

    Article Title: The phosphodiesterase 2A controls lymphatic junctional maturation via cGMP-dependent notch signaling.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Experimental models: Cell lines HDLECs PromoCell Cat# C-12216 HUVECs PromoCell Cat# C-12203 mECs This manuscript N/A Experimental models: Organisms/strains Mouse: Tie2-Cre (B6.Cg-Tg(Tek-cre) 1Ywa/J) Kisanuki et al.69 RRID:IMSR_JAX:008863 Mouse: Cdh5-CreERT2 (Tg(Cdh5-cre/ ERT2)1Rha) Sörensen et al.70 RRID:IMSR_EM:14891 Mouse: Prox1-CreERT2 (Tg(Prox1-cre/ ERT2)1Tmak Bazigou et al.71 RRID:IMSR_EM:13737 Mouse: Pde2a global knockout (B6; 129P2487Pde2A < tm1Dgen>/H; EM: 02366) Assenza et al.25 RRID:IMSR_EM:02366 Mouse: Pde2a (Pde2atm1a(EUCOMM)Wtsl) This manuscript N/A Oligonucleotides AllStars Negative CTRL siRNA Qiagen Cat# 1027281 FlexiTube PDE2A siRNA Qiagen Cat# SI00040159 DLL1 (hs00194509_m1) Thermo Fischer Scientific Cat# 4331182 GAPDH (hs99999905) Thermo Fischer Scientific Cat# 4326317E Gapdh (mm99999915_g1) Thermo Fischer Scientific Cat# 4352932E GJA4 (hs00704917_s1) Thermo Fischer Scientific Cat# 4331182 Hey1 (mm00468865_m1) Thermo Fischer Scientific Cat# 4331182 miR-139-5p (MI0000693) Thermo Fischer Scientific Cat# 002289 Mki67 (mm01278617_m1) Thermo Fischer Scientific Cat# 4331182 PDE10A (hs01098928_m1) Thermo Fischer Scientific Cat# 4351372 PDE12 (hs00698272_m1) Thermo Fischer Scientific Cat# 4331182 PDE2A (hs00159935_m1) Thermo Fischer Scientific Cat# 4331182 Pde2a (mm01136644_m1) Thermo Fischer Scientific Cat# 4331182 PDE3A (hs01012698_m1) Thermo Fischer Scientific Cat# 4331182 PDE4B (hs00963643_m1) Thermo Fischer Scientific Cat# 4331182 PDE4D (hs01579625_m1) Thermo Fischer Scientific Cat# 4331182 PDE6D (hs01062025_m1) Thermo Fischer Scientific Cat# 4331182 PDE8A (hs01079617_m1) Thermo Fischer Scientific Cat# 4331182 PSEN2 (hs01577197_m1) Thermo Fischer Scientific Cat# 4331182 RNU48 (TaqMan MicroRNA Assay) Thermo Fischer Scientific Cat# 001006 snoRNA202 (TaqMan MicroRNA Assay) Thermo Fischer Scientific Cat# 001232 snoRNA234 (TaqMan MicroRNA Assay) Thermo Fischer Scientific Cat# 001234 Pde2a-5’-arm 50ACTGGTCAGTTCTGAGC CTCACCC 30 This paper N/A Pde2a-3’-arm 50 AGTCTGGACTCCCCA TCTAGCAGG 30 This paper N/A Cre transgene sense 50GAACCTGATGG ACATGTTCAGG 30 This paper N/A Cre transgene antisense 50 AGTGCGTT CGAACGCTAGAGCCTGT 30 This paper N/A Myogenin sense 50 TTACGTCCA TCGTGGACAGC 30 This paper N/A Myogenin antisense 50 TGGGCTGGGT GTTAGCCTTA 30 This paper N/A (Continued on next page) e4 Developmental Cell 59, 1–18.e1–e11, February 5, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER Software and algorithms BioRad Image Lab Software BioRad N/A Diva 8.0.1 software BD Biosciences N/A Fiji ImageJ N/A https://imagej.net/ij/ GraphPad Prism 9 Dotmatics N/A Leica LAS-X software Leica N/A MicroManager 1.4 software Open source N/A Seurat package Satija et al.72 https://www.nature.com/articles/nbt.3192 umap package McInnes et al.73 https://joss.theoj.org/papers/10.21105/ joss.00861 Plotly software Open source https://plotly.com/r/ FastQC (v0.11.9) Open source http://www.bioinformatics.babraham.ac. uk/projects/fastqc/ Trimmomatic (v0.36) Bolger et al.74 https://academic.oup.com/bioinformatics/ article/30/15/2114/2390096?login=true STAR (v2.7.3a) Dobin et al.75 https://academic.oup.com/bioinformatics/ article/29/1/15/272537 ComBat-seq Zhang et al.76 https://academic.oup.com/nargab/article/ 2/3/lqaa078/5909519?searchresult=1 WebGestalt platform 2019 Liao et al.77 https://academic.oup.com/nar/article/47/ W1/W199/5494758?login=true Other 24-well Plate Softwell Easy Coat hydrogels (0.1, 1, 2, 4 and 25kPa) Matrigen Cat# SS24-EC 8-well Lab-Tek II chamber slides Lab-Tek Cat# 154941 Agilent Technologies 2100 bioanalyzer Agilent https://www.agilent.com/en/product/ automated-electrophoresis/bioanalyzersystems/bioanalyzer-instrument AMPure XP magnetic beads Beckman Cat# A53880 Axiocam 208 Color Zeiss N/A BD Biosciences FACSAria IIIu BD Biosciences N/A CoolLED beam-splitter DV2 Dual View Photometrics N/A CMOS camera chip OptiMOS, Qimaging N/A DEAE-Sephadex A-25 columns Cytiva Cat# 17017001 DynaMag -2 Invitrogen Cat# 12321D Gel Doc MP Imaging System BioRad N/A Hamilton TLC syringe Sigma-Aldrich Cat# HAM7635-01-1EA Immobilion -P Transfer Membrane (0.45mm pore size) Merck Cat# IPVH00010 Inject -F syringe Braun Cat# 9166017V Leica DMI 3000 B inverted fluorescent microscope Leica N/A Leica SP8 inverted microscope Leica N/A Nikon Eclipse Ts2R microscope Nikon N/A Sheep-anti-rat IgG Dynabeads Invitrogen Cat# 110-35 StepOnePlus RT PCR system Applied Biosystems N/A Tecan Spark 10M microplate reader Tecan N/A Tissue culture-treated dishes Corning Cat# 430167 Tissue culture-treated dishes (60mm) Corning Cat# 430166 Transwell filters (0.4mm pore size) Corning Cat# 3413 (Continued on next page) Developmental Cell 59, 1–18.e1–e11, February 5, 2024 e5 .. REAGENT or RESOURCE SOURCE IDENTIFIER Tri-Carb 2100TR Liquid Scintillation Counter Packard Instruments Cat# 2000CA ULTIMA GOLD scintillation liquid PerkinElmer Cat# 6013326 UltraComp eBeads Plus Compensation Beads Invitrogen Cat# 01-3333-42 Zeiss Stemi 508 Zeiss N/A

    Article Title: Reversal of diet-induced obesity by central insulin sensitizer FSTL1.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Experimental models: Organisms/strains Mouse: C57BL/6J The GemPharmatech N000013 Mouse: db/db The GemPharmatech T002407 Mouse: ob/ob The GemPharmatech T001461 Mouse: AgRP-Cre Gift from Prof. Shu 61 N/A Mouse: Rosa26-tdTomato Gift from Prof. Guo 62 N/A Mouse: Fstl1 fl/fl Gift from Prof. Ning 63 N/A Oligonucleotides Pomc: Forward: CCTTGGCTAGATAACGAACTCTG Merck N/A Pomc: Reverse: AGATGACGTGGCAAAGAACAG Merck N/A Agrp: Forward: CCTCGTCGAACTCTATTCCCAG Merck N/A Agrp: Reverse: ACCAAGCCTACTACCATCATCG Merck N/A Npy: Forward: TAGGAGTAGTGCCCAAATGC Merck N/A Npy: Reverse: AAGAGCCTGGTCAAGTTCTG Merck N/A β-actin: Forward: CAGTGTCCATCCTCTGAGTAGC Merck N/A β-actin: Reverse: GGCATAAACGCAGAGCATTCCTG Merck N/A Software and algorithms ChemiDoc Imaging System BioRad RRID: SCR_014210 GraphPad Prism 9.1.0 Prism RRID:SCR_002798 Fiji NIH https://imagej.net/Fiji/Downloads SPSS IBM http://www.spss.com.cn/ Leica Application Suite Leica Microsystems https://www.leica-microsystems.com/ products/microscope-software/p/ leicalas-x-ls/ Biorender Biorender.com https://www.biorender.com/ e2 Neuron 114, 1–20.e1–e5, January 7, 2026 .. Eight-week-old male C57BL/6J mice and db/db and ob/ob mice were purchased from GemPharmatech Co., Ltd. (Nanjing, China).

    Real-time Polymerase Chain Reaction:

    Article Title: Human conjunctiva organoids to study ocular surface homeostasis and disease.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER BSA MP biomedicals 160069 Triton X-100 Sigma-Aldrich X100-100ML Pertex Klinipath AM-08010 pSpCas9(BB)-2A-GFP gRNA cloning reagents Ran et al.90 N/A BTXpress solution BTX 45-0805 DTT Sigma Aldrich D0632 Lysyl endopeptidase (Lys C) Wako Chemicals GmbH 129-05061 Reversed-phase C18 1cc columns Waters Corporation WAT054925 Trypsin Sigma Aldrich T1426 Fibrin TISSEEL Baxter 1506079 Critical Commercial Assays RNeasy Mini Kit QIAGEN 74104 QIAquick PCR Purification Kit QIAGEN 28104 Quick-DNA Microprep kit Zymogen ZY-D3020 Chromium 3’ Gene Expression solution v3.1 10x Genomics PN-120237 TruSeq Stranded mRNA kit Illumina N/A pJet cloning kit Thermo Fisher scientific K1232 Miniprep DNA isolation kit Thermo Fisher scientific K210003 Midiprep DNA isolation kit Thermo Fisher scientific K210005 Micro BCA Protein Assay Kit Bio-Rad 23235 4-15% Mini-PROTEAN precast protein gel 10-well 30 mL Bio-Rad 4561083 ECL Prime Western blotting detection reagent GE Healthcare Life Sciences RPN2232 Deposited Data Raw and processed mouse conjunctiva bulk mRNA sequencing data This paper GEO: GSE205926 Raw and processed human conjunctiva single-cell mRNA sequencing data This paper GEO: GSE242382 Raw and processed human conjunctiva infected with HSV1 and hAdV8 bulk mRNA sequencing data This paper GEO: GSE205925 Processed human lung single-cell atlas Travaglini et al.91 https://www.synapse.org/ #!Synapse:syn21041850 Processed human gut single-cell atlas: epithelial cells Elmentaite et al.92 https://www.gutcellatlas.org/ Processed human stomach single-cell atlas Kumar et al.93 GEO: GSE183904 Pterygium and healthy conjunctiva bulk mRNA sequencing data Wolf et al.23 GEO: GSE155776 Raw conjunctival secretome data This paper ProteomeXchange: PXD043550 Compiled code used for human single-cell RNA sequencing analysis This paper https://github.com/MarieBannier/ Conjunctiva Seurat objects of human conjunctiva single-cell RNA sequencing This paper Zenodo: 8403667 Experimental Models: Organisms/Strains C57BL/6 mice Hubrecht Institute N/A NOD Scid Gamma (NSG) mice Hubrecht Institute N/A HSV1-tdTomato Etienne et al.52 N/A hAdV8 This paper N/A SARS-CoV-2 (ancestral strain, 614G) EVAg 026V-03883 SARS-CoV-2 (Delta variant) GenBank OM287123 (Continued on next page) e3 Cell Stem Cell 31, 1–17.e1–e12, February 1, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER Oligonucleotides qPCR primers This paper, Bannier-Hélaou€et et al.,81 and Table S7 N/A Viral titer primers This paper, Corman et al.,94 Lõhmussaar et al.,87 Miura-Ochiai et al.,95 and Table S7 N/A Pax6 KO primers Bannier-Hélaou€et et al.81 and Table S7 N/A Software and Algorithms CFX manager software Bio-Rad N/A Seurat v3 and v4 Stuart et al. and Hao et al.96,97 https://satijalab.org/seurat/index.html Samtools v1.10 Li98 http://www.htslib.org/ umi_tools v1.1.1 Smith et al.99 https://github.com/CGATOxford/UMI-tools CellRanger v7.1.0 10x genomics https://support.10xgenomics.com/ single-cell-gene-expression/software/ pipelines/latest/installation Souporcell Heaton et al.100 https://github.com/wheaton5/souporcell DESeq2 v1.26.0 Love et al.101 https://github.com/mikelove/DESeq2 Goseq Young et al.102 https://rdrr.io/github/nadiadavidson/goseq/ clusterProfiler v3.14.0 Yu et al.103 https://github.com/YuLab-SMU/clusterProfiler ChIPpeakAnno v3.20.0 Zhu et al.104 https://rdrr.io/bioc/ChIPpeakAnno/man/ Python Python https://www.python.org/ R version 4.1.0 R Core https://www.r-project.org/ Rstudio Rstudio https://rstudio.com/ MaxQuant v2.4.2.0 MaxQuant https://www.maxquant.org/ Uniprot human database Uniprot https://www.uniprot.org/ Perseus v1.6.15.0 Max Planck Institute of Biochemistry https://maxquant.net/perseus/ GraphPad PRISM 9 GraphPad N/A Las X Leica N/A Adobe illustrator Adobe inc. N/A Fiji NIH, Fiji developers https://imagej.net/Fiji Other EVOS FL Auto 2 Cell Imaging System Thermo Fisher scientific N/A ImageQuant LAS 4000 ECL western blot imager GE Healthcare Life Sciences N/A LSM700 confocal microscope Zeiss N/A SP8 confocal microscope Leica N/A SP8X confocal microscope Leica N/A DM4000 Leica N/A NEPA21 electroporator Nepagene N/A Ultramicrotome Ultracut Leica N/A Tecnai T12 electron microscope Thermo Fisher scientific N/A Eagle 4k*4k CCD camera Thermo Fisher scientific N/A NovaSeq6000 Illumina N/A CFX384 Touch Real-Time PCR detection system Bio-Rad N/A Spark multimode microplate reader Tecan N/A 12-well suspension plates Greiner 665102 24-well suspension plates Greiner 662102 (Continued on next page) Cell Stem Cell 31, 1–17.e1–e12, February 1, 2024 e4 .. REAGENT or RESOURCE SOURCE IDENTIFIER Thincert cell culture insert for 24 well plates Greiner 662630 Orbitrap Eclipse Tribrid Mass Spectrometer Thermo Fisher scientific N/A Vanquish Neo UHPLC System Thermo Fisher scientific N/A Easy-Spray PepMap Neo 2 mm C18 75 mm X 500 mm Thermo Fisher scientific ES75500PN FACSFusion BD Biosciences N/A FACSAria BD Biosciences N/A FACSJazz BD Biosciences N/A

    Article Title: Multi-dimensional metabolomic remodeling under diverse muscle atrophic stimuli in vivo.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER TSKgel Amide-80 (3.0 μm, 2.0 mm × 15 cm TOSOH Corporation Cat# 0021865 G266 DNA Damage Detection Kit - γH2AX - Red Dojindo Molecular Technologies Cat# 340-09431 HEPES Nacalai Tesque Cat# 02443-34 Trichloroacetic acid Nacalai Tesque Cat# 06275-24 L-Methionine sulfome Thermo Fisher Cat# A17027 Takara Taq Takara Cat# R001A Takara Ex Taq Takara Cat# RR001A Agarose for ≧1kbp fragment (Fine Powder) Nacalai Tesque Cat# 02468-95 100 bp DNA ladder One Nacalai Tesque Cat# 07908-75 6x Loading Dye Toyobo Cat# RE-DYE Ethidium Bromide Solution Nacalai Tesque Cat# 14631-94 Sodium Chloride Nacalai Tesque Cat# 31320-05 Bacto TM Peptone DIFCO Cat# 0118-17-0 Extract Yeast Dried Nacalai Tesque Cat# 15838-45 Bacto TM Agar BD Cat# 214010 Competent Quick DH5α Toyobo Cat# DNA-913 Ampicillin Sodium Salt Nacalai Tesque Cat# 02739-74 KOD-Plus-Neo Toyobo Cat# KOD-401 QIAGEN Plasmid Midi kit QIAGEN Cat# 12145 Calf intestine alkarine phosphatase Takara Cat# 2250A QIAEX II Gel Extraction Kit QIAGEN Cat# 20021 DNA Ligation Kit Ver.2.1 Takara Cat# 6022 Venoject II Terumo Cat# VP-DK051K Isoflurane Viatris – Domitor Nippon Zenyaku Kogyo – Midazolam Sandoz – Vetorphale Meiji Seika Pharma – Antisedan Nippon Zenyaku Kogyo – Deposited data Metabolomics data (Skeletal muscle, FoxO1 overexpression and immobilization, FoxO1-Tg and C57BL/6J) https://www. metabolomicsworkbench.org Metabolomics Workbench Study ID: ST003721; Project ID: PR002310 Metabolomics data (plasma, FoxO1 overexpression and immobilization, FoxO1-Tg and C57BL/6J) https://www. metabolomicsworkbench.org Metabolomics Workbench Study ID: ST003722; Project ID: PR002311 Metabolomics data (Skeletal muscle, Cancer cachexia and starvation, C57BL/6J) https://www. metabolomicsworkbench.org Metabolomics Workbench Study ID: ST003723; Project ID: PR002312 Metabolomics data (Skeletal muscle, immobilization, mFoxO1,3,4 flox/flox and mFoxO1,3,4 − /− ) https://www. metabolomicsworkbench.org Metabolomics Workbench Study ID: ST003724; Project ID: PR002313 Experimental models: Cell lines LLC cells: LL/2 (LLC1) ATCC CRL-1642 Primary myoblast This paper N/A C2C12 myoblasts Riken Cell Bank RCB0987 C2C12 myoblasts (Western blot analysis for SUnSET analysis and MG-132 experiment) ATCC CRL-1772 HEK293T cells Oyabu et al. 29 N/A Experimental models: Organisms/strains Mouse: C57BL/6J CLEA – Mouse: HSA-FOXO1-Tg Kamei Lab N/A Mouse: HSA-Cre FoxO1,3,4 flox/flox Kamei Lab N/A Mouse: HSA-DN-FOXO1-Tg Yamazaki et al. 42 N/A (Continued on next page) Cell Reports 44, 116097, August 26, 2025 19 .. REAGENT or RESOURCE SOURCE IDENTIFIER Oligonucleotides Primers for genotyping This paper Table S1 Primer for RT-qPCR This paper Table S2 MISSION siRNA Universal Negative Control #1 Sigma-Aldrich Cat# SIC001 MISSION siAmd2_1 Sigma-Aldrich Cat# SASI_Mm02_00311615 MISSION siAmd2_2 Sigma-Aldrich Cat# SASI_Mm01_00156378 Recombinant DNA pCAG-FOXO1(3A) Oyabu et al. 29 N/A pCMX-GFP Oyabu et al. 29 N/A pGL3-Odc1 promoter-luciferase This paper N/A phRL-TK Promega Cat# E2241 Software and algorithms Prism 10 software GraphPad Software – ImageJ NIH https://imagej.nih.gov/ij/download.html BZ-X800 Viewer Keyence – BZ-X800 Analyzer Keyence – ImageLab software Bio-Rad – Venn Diagrams Bioinformatics & Evolutionary Genomics http://bioinformatics.psb.ugent.be/ webtools/Venn/ Cluster 3.0 de Hoon et al. 43 http://bonsai.hgc.jp/∼mdehoon/ software/cluster/ Java TreeView Saldanha et al. 44 https://jtreeview.sourceforge.net MasterHands ver.2 software (Keio University, Tsuruoka, Yamagata, Japan) Sugimoto t al. 45 N/A MetaboAnalyst Pang et al. 46 https://www.metaboanalyst.ca/ LabSolutions LCMS Shimadzu N/A RNAseqChef Etoh and Nakao 47 https://imeg-ku.shinyapps.io/RNAseqChef/ GREIN: GEO RNA-seq Experiments Interactive Navigator Mahi et al. 48 https://www.ilincs.org/apps/grein/ SarcoAtlas Ham et al. 49 and Borsch et al. 50 https://sarcoatlas.scicore.unibas.ch Ensembl Harrison et al. 51 https://asia.ensembl.org Clustal Omega Multiple sequence Alighment (MSA) Madeira et al. 52 https://www.ebi.ac.uk/ jdispatcher/msa/clustalo R system R Core Team https://cran.r-project.org Programming environment of R: RStudio RStudio Team https://www.rstudio.com Adobe Illustrator Adobe https://www.adobe.com Excel Microsoft https://www.microsoft.com/ en-us/microsoft-365/excel BioRender: Scientific Image and Illustration Software N/A https://www.biorender.com Primer Express 2.0 Thermo Fisher – Primer-BLAST NIH https://www.ncbi.nlm.nih.gov/tools/primer- blast/https://www.ilincs.org/apps/grein/ Other Metabolomic analyses (CE-TOFMS) Human Metabolome Technologies N/A Agilent CE-TOFMS system Agilent Technologies – LCMS-8040 triple quadrupole mass spectrometer Shimadzu – Grip strength meter Melquest Cat# GPM-101B CFX Connect Real-Time PCR Detection System Bio-Rad Cat# 1855201J1 ChemiDoc XRS+ Imaging System Bio-Rad Cat# 1708265J1 (Continued on next page) 20 Cell Reports 44, 116097, August 26, 2025 ..

    Western Blot:

    Article Title: Human conjunctiva organoids to study ocular surface homeostasis and disease.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER BSA MP biomedicals 160069 Triton X-100 Sigma-Aldrich X100-100ML Pertex Klinipath AM-08010 pSpCas9(BB)-2A-GFP gRNA cloning reagents Ran et al.90 N/A BTXpress solution BTX 45-0805 DTT Sigma Aldrich D0632 Lysyl endopeptidase (Lys C) Wako Chemicals GmbH 129-05061 Reversed-phase C18 1cc columns Waters Corporation WAT054925 Trypsin Sigma Aldrich T1426 Fibrin TISSEEL Baxter 1506079 Critical Commercial Assays RNeasy Mini Kit QIAGEN 74104 QIAquick PCR Purification Kit QIAGEN 28104 Quick-DNA Microprep kit Zymogen ZY-D3020 Chromium 3’ Gene Expression solution v3.1 10x Genomics PN-120237 TruSeq Stranded mRNA kit Illumina N/A pJet cloning kit Thermo Fisher scientific K1232 Miniprep DNA isolation kit Thermo Fisher scientific K210003 Midiprep DNA isolation kit Thermo Fisher scientific K210005 Micro BCA Protein Assay Kit Bio-Rad 23235 4-15% Mini-PROTEAN precast protein gel 10-well 30 mL Bio-Rad 4561083 ECL Prime Western blotting detection reagent GE Healthcare Life Sciences RPN2232 Deposited Data Raw and processed mouse conjunctiva bulk mRNA sequencing data This paper GEO: GSE205926 Raw and processed human conjunctiva single-cell mRNA sequencing data This paper GEO: GSE242382 Raw and processed human conjunctiva infected with HSV1 and hAdV8 bulk mRNA sequencing data This paper GEO: GSE205925 Processed human lung single-cell atlas Travaglini et al.91 https://www.synapse.org/ #!Synapse:syn21041850 Processed human gut single-cell atlas: epithelial cells Elmentaite et al.92 https://www.gutcellatlas.org/ Processed human stomach single-cell atlas Kumar et al.93 GEO: GSE183904 Pterygium and healthy conjunctiva bulk mRNA sequencing data Wolf et al.23 GEO: GSE155776 Raw conjunctival secretome data This paper ProteomeXchange: PXD043550 Compiled code used for human single-cell RNA sequencing analysis This paper https://github.com/MarieBannier/ Conjunctiva Seurat objects of human conjunctiva single-cell RNA sequencing This paper Zenodo: 8403667 Experimental Models: Organisms/Strains C57BL/6 mice Hubrecht Institute N/A NOD Scid Gamma (NSG) mice Hubrecht Institute N/A HSV1-tdTomato Etienne et al.52 N/A hAdV8 This paper N/A SARS-CoV-2 (ancestral strain, 614G) EVAg 026V-03883 SARS-CoV-2 (Delta variant) GenBank OM287123 (Continued on next page) e3 Cell Stem Cell 31, 1–17.e1–e12, February 1, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER Oligonucleotides qPCR primers This paper, Bannier-Hélaou€et et al.,81 and Table S7 N/A Viral titer primers This paper, Corman et al.,94 Lõhmussaar et al.,87 Miura-Ochiai et al.,95 and Table S7 N/A Pax6 KO primers Bannier-Hélaou€et et al.81 and Table S7 N/A Software and Algorithms CFX manager software Bio-Rad N/A Seurat v3 and v4 Stuart et al. and Hao et al.96,97 https://satijalab.org/seurat/index.html Samtools v1.10 Li98 http://www.htslib.org/ umi_tools v1.1.1 Smith et al.99 https://github.com/CGATOxford/UMI-tools CellRanger v7.1.0 10x genomics https://support.10xgenomics.com/ single-cell-gene-expression/software/ pipelines/latest/installation Souporcell Heaton et al.100 https://github.com/wheaton5/souporcell DESeq2 v1.26.0 Love et al.101 https://github.com/mikelove/DESeq2 Goseq Young et al.102 https://rdrr.io/github/nadiadavidson/goseq/ clusterProfiler v3.14.0 Yu et al.103 https://github.com/YuLab-SMU/clusterProfiler ChIPpeakAnno v3.20.0 Zhu et al.104 https://rdrr.io/bioc/ChIPpeakAnno/man/ Python Python https://www.python.org/ R version 4.1.0 R Core https://www.r-project.org/ Rstudio Rstudio https://rstudio.com/ MaxQuant v2.4.2.0 MaxQuant https://www.maxquant.org/ Uniprot human database Uniprot https://www.uniprot.org/ Perseus v1.6.15.0 Max Planck Institute of Biochemistry https://maxquant.net/perseus/ GraphPad PRISM 9 GraphPad N/A Las X Leica N/A Adobe illustrator Adobe inc. N/A Fiji NIH, Fiji developers https://imagej.net/Fiji Other EVOS FL Auto 2 Cell Imaging System Thermo Fisher scientific N/A ImageQuant LAS 4000 ECL western blot imager GE Healthcare Life Sciences N/A LSM700 confocal microscope Zeiss N/A SP8 confocal microscope Leica N/A SP8X confocal microscope Leica N/A DM4000 Leica N/A NEPA21 electroporator Nepagene N/A Ultramicrotome Ultracut Leica N/A Tecnai T12 electron microscope Thermo Fisher scientific N/A Eagle 4k*4k CCD camera Thermo Fisher scientific N/A NovaSeq6000 Illumina N/A CFX384 Touch Real-Time PCR detection system Bio-Rad N/A Spark multimode microplate reader Tecan N/A 12-well suspension plates Greiner 665102 24-well suspension plates Greiner 662102 (Continued on next page) Cell Stem Cell 31, 1–17.e1–e12, February 1, 2024 e4 .. REAGENT or RESOURCE SOURCE IDENTIFIER Thincert cell culture insert for 24 well plates Greiner 662630 Orbitrap Eclipse Tribrid Mass Spectrometer Thermo Fisher scientific N/A Vanquish Neo UHPLC System Thermo Fisher scientific N/A Easy-Spray PepMap Neo 2 mm C18 75 mm X 500 mm Thermo Fisher scientific ES75500PN FACSFusion BD Biosciences N/A FACSAria BD Biosciences N/A FACSJazz BD Biosciences N/A

    Article Title: Adipocyte PI3K links adipostasis with baseline insulin secretion at fasting through an adipoincretin effect.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies AKT Phospho (Thr308) Cell Signaling 4056; RRID: AB_331163 AKT Phospho (Ser373) XP Cell Signaling 4060; RRID: AB_2315049 AKT Cell Signaling 9272; RRID: AB_329827 Erk 1/2 (p44/42 MAPK) Phospho(Thr202/Tyr204) XP Cell Signaling 9101; RRID: AB_331646 Erk 1/2 (p44/42 MAPK) Cell Signaling 9102; RRID: AB_330744 IRS1 Millipore 06248; RRID: AB_2127890 IRS2 Millipore MABS15; RRID: AB_1121131 PI3K p85 Cell Signaling 4257; RRID: AB_659889 PI3K p85a Abcam Ab133595 PI3K p55g Abcam Ab238509 Tubulin a/b Cell Signaling 2148; RRID: AB_2288042 PI3Ka Cell Signaling 4249; RRID: AB_2165248 PI3Kb Cell Signaling 3011; RRID: AB_2165246 PI3Kd Millipore 04–401; RRID: AB_673111 PI3Kg a gift of Prof. Matthias Wymann University of Basel (Russian) HSL Phospho (Ser563) Cell Signaling 4139; RRID: AB_2135495 HSL Phospho (Ser660) Cell Signaling 4126; RRID: AB_490997 HSL Phospho (Ser565) Cell Signaling 4137; RRID: AB_2135498 HSL Cell Signaling 4107; RRID: AB_2296900 Chemicals, peptides, and recombinant proteins Insulin Humalog Lilly VL7510 Glucose Acros 410955000 BSA Fisher Scientific BP9702 ECL-anti rabbit IgG HRP GE Healthcare NA934V ECL-anti mouse IgG HRP GE Healthcare LNA931V Collagenase P Roche 11213865001 GSK2636771 (Inhibitor PI3Kb) SelleckChem S8002 TGX-221 (Inhibitor PI3Kb) MedChem Express HY-10114 IPI549 (Inhibitor PI3Kg) MedChem Express(SelleckChem) HY-100716 PIK294 (Inhibitor PI3Kd) MedChem Express HY-10303 Buparlisib (BKM120, panPI3K inhibitor) MedChem Express HY-70063 Taselisib (GDC-0032, panPI3K inhibitor) MedChem Express HY-13898 Nicotinic Acid Sigma 72309 Atglistatin MedChem Express HY-15859 Cremophor EL Millipore 238470 CL 316,243 Sigma C5976 Critical commercial assays Insulin ELISA Kit Crystal Chem 90080 C-peptide Elisa Kit Crystal Chem 90050 FFA (NEFA-HR set) Fuji Film 436-91995, 434-91795 91096 (standard) Leptin Elisa Kit R&D MOB00B (Continued on next page) Cell Reports 43, 114132, May 28, 2024 17 .. REAGENT or RESOURCE SOURCE IDENTIFIER Adipsin Elisa Kit R&D DY5430-05 FABP4 Elisa Kit BioVendor RD191036200R Asprosin Elisa Kit Abbexa abx585287 Adrenaline Elisa Kit LDN BA E 5100R Corticosterone Elisa Kit IDS AC-14F1 Glucagon Elisa Kit Crystal Chem 81518 Mouse Growth factor Elisa Kit Crystal Chem 80587 Glycerol Assay Kit Sigma-Aldrich MAK117 b-Hydroxybutyrate Assay Kit Sigma-Aldrich MAK041 Immobilon Western Chemiluminescence HRP substrate Millipore WBKLS0500 Hematoxylin Solution (Mayer’s, Modified) Abcam AB220365 Eosin Sigma HT110116 Deposited data Immunoblots images This paper https://doi.org/10.17632/tgsgkjz28w.1 Experimental models: Organisms/strains WT C57BL/6 background Janvier Labs PI3KaF/F Mixed background Provided by Victoria Rotter Sopasakis PI3KaAdQ Mixed background Provided by Victoria Rotter Sopasakis Software and algorithms Image Lab software (version 5.2.1) Bio-Rad http://www.bio-rad.com/en-us/ product/image-lab-software Graph Pad Prism 7.0 Graph Pad Software N/A AxioVision Software Imaging Sofware Carl Zeiss Microscopy ..

    Microscopy:

    Article Title: Human conjunctiva organoids to study ocular surface homeostasis and disease.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER BSA MP biomedicals 160069 Triton X-100 Sigma-Aldrich X100-100ML Pertex Klinipath AM-08010 pSpCas9(BB)-2A-GFP gRNA cloning reagents Ran et al.90 N/A BTXpress solution BTX 45-0805 DTT Sigma Aldrich D0632 Lysyl endopeptidase (Lys C) Wako Chemicals GmbH 129-05061 Reversed-phase C18 1cc columns Waters Corporation WAT054925 Trypsin Sigma Aldrich T1426 Fibrin TISSEEL Baxter 1506079 Critical Commercial Assays RNeasy Mini Kit QIAGEN 74104 QIAquick PCR Purification Kit QIAGEN 28104 Quick-DNA Microprep kit Zymogen ZY-D3020 Chromium 3’ Gene Expression solution v3.1 10x Genomics PN-120237 TruSeq Stranded mRNA kit Illumina N/A pJet cloning kit Thermo Fisher scientific K1232 Miniprep DNA isolation kit Thermo Fisher scientific K210003 Midiprep DNA isolation kit Thermo Fisher scientific K210005 Micro BCA Protein Assay Kit Bio-Rad 23235 4-15% Mini-PROTEAN precast protein gel 10-well 30 mL Bio-Rad 4561083 ECL Prime Western blotting detection reagent GE Healthcare Life Sciences RPN2232 Deposited Data Raw and processed mouse conjunctiva bulk mRNA sequencing data This paper GEO: GSE205926 Raw and processed human conjunctiva single-cell mRNA sequencing data This paper GEO: GSE242382 Raw and processed human conjunctiva infected with HSV1 and hAdV8 bulk mRNA sequencing data This paper GEO: GSE205925 Processed human lung single-cell atlas Travaglini et al.91 https://www.synapse.org/ #!Synapse:syn21041850 Processed human gut single-cell atlas: epithelial cells Elmentaite et al.92 https://www.gutcellatlas.org/ Processed human stomach single-cell atlas Kumar et al.93 GEO: GSE183904 Pterygium and healthy conjunctiva bulk mRNA sequencing data Wolf et al.23 GEO: GSE155776 Raw conjunctival secretome data This paper ProteomeXchange: PXD043550 Compiled code used for human single-cell RNA sequencing analysis This paper https://github.com/MarieBannier/ Conjunctiva Seurat objects of human conjunctiva single-cell RNA sequencing This paper Zenodo: 8403667 Experimental Models: Organisms/Strains C57BL/6 mice Hubrecht Institute N/A NOD Scid Gamma (NSG) mice Hubrecht Institute N/A HSV1-tdTomato Etienne et al.52 N/A hAdV8 This paper N/A SARS-CoV-2 (ancestral strain, 614G) EVAg 026V-03883 SARS-CoV-2 (Delta variant) GenBank OM287123 (Continued on next page) e3 Cell Stem Cell 31, 1–17.e1–e12, February 1, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER Oligonucleotides qPCR primers This paper, Bannier-Hélaou€et et al.,81 and Table S7 N/A Viral titer primers This paper, Corman et al.,94 Lõhmussaar et al.,87 Miura-Ochiai et al.,95 and Table S7 N/A Pax6 KO primers Bannier-Hélaou€et et al.81 and Table S7 N/A Software and Algorithms CFX manager software Bio-Rad N/A Seurat v3 and v4 Stuart et al. and Hao et al.96,97 https://satijalab.org/seurat/index.html Samtools v1.10 Li98 http://www.htslib.org/ umi_tools v1.1.1 Smith et al.99 https://github.com/CGATOxford/UMI-tools CellRanger v7.1.0 10x genomics https://support.10xgenomics.com/ single-cell-gene-expression/software/ pipelines/latest/installation Souporcell Heaton et al.100 https://github.com/wheaton5/souporcell DESeq2 v1.26.0 Love et al.101 https://github.com/mikelove/DESeq2 Goseq Young et al.102 https://rdrr.io/github/nadiadavidson/goseq/ clusterProfiler v3.14.0 Yu et al.103 https://github.com/YuLab-SMU/clusterProfiler ChIPpeakAnno v3.20.0 Zhu et al.104 https://rdrr.io/bioc/ChIPpeakAnno/man/ Python Python https://www.python.org/ R version 4.1.0 R Core https://www.r-project.org/ Rstudio Rstudio https://rstudio.com/ MaxQuant v2.4.2.0 MaxQuant https://www.maxquant.org/ Uniprot human database Uniprot https://www.uniprot.org/ Perseus v1.6.15.0 Max Planck Institute of Biochemistry https://maxquant.net/perseus/ GraphPad PRISM 9 GraphPad N/A Las X Leica N/A Adobe illustrator Adobe inc. N/A Fiji NIH, Fiji developers https://imagej.net/Fiji Other EVOS FL Auto 2 Cell Imaging System Thermo Fisher scientific N/A ImageQuant LAS 4000 ECL western blot imager GE Healthcare Life Sciences N/A LSM700 confocal microscope Zeiss N/A SP8 confocal microscope Leica N/A SP8X confocal microscope Leica N/A DM4000 Leica N/A NEPA21 electroporator Nepagene N/A Ultramicrotome Ultracut Leica N/A Tecnai T12 electron microscope Thermo Fisher scientific N/A Eagle 4k*4k CCD camera Thermo Fisher scientific N/A NovaSeq6000 Illumina N/A CFX384 Touch Real-Time PCR detection system Bio-Rad N/A Spark multimode microplate reader Tecan N/A 12-well suspension plates Greiner 665102 24-well suspension plates Greiner 662102 (Continued on next page) Cell Stem Cell 31, 1–17.e1–e12, February 1, 2024 e4 .. REAGENT or RESOURCE SOURCE IDENTIFIER Thincert cell culture insert for 24 well plates Greiner 662630 Orbitrap Eclipse Tribrid Mass Spectrometer Thermo Fisher scientific N/A Vanquish Neo UHPLC System Thermo Fisher scientific N/A Easy-Spray PepMap Neo 2 mm C18 75 mm X 500 mm Thermo Fisher scientific ES75500PN FACSFusion BD Biosciences N/A FACSAria BD Biosciences N/A FACSJazz BD Biosciences N/A

    Article Title: The phosphodiesterase 2A controls lymphatic junctional maturation via cGMP-dependent notch signaling.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Experimental models: Cell lines HDLECs PromoCell Cat# C-12216 HUVECs PromoCell Cat# C-12203 mECs This manuscript N/A Experimental models: Organisms/strains Mouse: Tie2-Cre (B6.Cg-Tg(Tek-cre) 1Ywa/J) Kisanuki et al.69 RRID:IMSR_JAX:008863 Mouse: Cdh5-CreERT2 (Tg(Cdh5-cre/ ERT2)1Rha) Sörensen et al.70 RRID:IMSR_EM:14891 Mouse: Prox1-CreERT2 (Tg(Prox1-cre/ ERT2)1Tmak Bazigou et al.71 RRID:IMSR_EM:13737 Mouse: Pde2a global knockout (B6; 129P2487Pde2A < tm1Dgen>/H; EM: 02366) Assenza et al.25 RRID:IMSR_EM:02366 Mouse: Pde2a (Pde2atm1a(EUCOMM)Wtsl) This manuscript N/A Oligonucleotides AllStars Negative CTRL siRNA Qiagen Cat# 1027281 FlexiTube PDE2A siRNA Qiagen Cat# SI00040159 DLL1 (hs00194509_m1) Thermo Fischer Scientific Cat# 4331182 GAPDH (hs99999905) Thermo Fischer Scientific Cat# 4326317E Gapdh (mm99999915_g1) Thermo Fischer Scientific Cat# 4352932E GJA4 (hs00704917_s1) Thermo Fischer Scientific Cat# 4331182 Hey1 (mm00468865_m1) Thermo Fischer Scientific Cat# 4331182 miR-139-5p (MI0000693) Thermo Fischer Scientific Cat# 002289 Mki67 (mm01278617_m1) Thermo Fischer Scientific Cat# 4331182 PDE10A (hs01098928_m1) Thermo Fischer Scientific Cat# 4351372 PDE12 (hs00698272_m1) Thermo Fischer Scientific Cat# 4331182 PDE2A (hs00159935_m1) Thermo Fischer Scientific Cat# 4331182 Pde2a (mm01136644_m1) Thermo Fischer Scientific Cat# 4331182 PDE3A (hs01012698_m1) Thermo Fischer Scientific Cat# 4331182 PDE4B (hs00963643_m1) Thermo Fischer Scientific Cat# 4331182 PDE4D (hs01579625_m1) Thermo Fischer Scientific Cat# 4331182 PDE6D (hs01062025_m1) Thermo Fischer Scientific Cat# 4331182 PDE8A (hs01079617_m1) Thermo Fischer Scientific Cat# 4331182 PSEN2 (hs01577197_m1) Thermo Fischer Scientific Cat# 4331182 RNU48 (TaqMan MicroRNA Assay) Thermo Fischer Scientific Cat# 001006 snoRNA202 (TaqMan MicroRNA Assay) Thermo Fischer Scientific Cat# 001232 snoRNA234 (TaqMan MicroRNA Assay) Thermo Fischer Scientific Cat# 001234 Pde2a-5’-arm 50ACTGGTCAGTTCTGAGC CTCACCC 30 This paper N/A Pde2a-3’-arm 50 AGTCTGGACTCCCCA TCTAGCAGG 30 This paper N/A Cre transgene sense 50GAACCTGATGG ACATGTTCAGG 30 This paper N/A Cre transgene antisense 50 AGTGCGTT CGAACGCTAGAGCCTGT 30 This paper N/A Myogenin sense 50 TTACGTCCA TCGTGGACAGC 30 This paper N/A Myogenin antisense 50 TGGGCTGGGT GTTAGCCTTA 30 This paper N/A (Continued on next page) e4 Developmental Cell 59, 1–18.e1–e11, February 5, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER Software and algorithms BioRad Image Lab Software BioRad N/A Diva 8.0.1 software BD Biosciences N/A Fiji ImageJ N/A https://imagej.net/ij/ GraphPad Prism 9 Dotmatics N/A Leica LAS-X software Leica N/A MicroManager 1.4 software Open source N/A Seurat package Satija et al.72 https://www.nature.com/articles/nbt.3192 umap package McInnes et al.73 https://joss.theoj.org/papers/10.21105/ joss.00861 Plotly software Open source https://plotly.com/r/ FastQC (v0.11.9) Open source http://www.bioinformatics.babraham.ac. uk/projects/fastqc/ Trimmomatic (v0.36) Bolger et al.74 https://academic.oup.com/bioinformatics/ article/30/15/2114/2390096?login=true STAR (v2.7.3a) Dobin et al.75 https://academic.oup.com/bioinformatics/ article/29/1/15/272537 ComBat-seq Zhang et al.76 https://academic.oup.com/nargab/article/ 2/3/lqaa078/5909519?searchresult=1 WebGestalt platform 2019 Liao et al.77 https://academic.oup.com/nar/article/47/ W1/W199/5494758?login=true Other 24-well Plate Softwell Easy Coat hydrogels (0.1, 1, 2, 4 and 25kPa) Matrigen Cat# SS24-EC 8-well Lab-Tek II chamber slides Lab-Tek Cat# 154941 Agilent Technologies 2100 bioanalyzer Agilent https://www.agilent.com/en/product/ automated-electrophoresis/bioanalyzersystems/bioanalyzer-instrument AMPure XP magnetic beads Beckman Cat# A53880 Axiocam 208 Color Zeiss N/A BD Biosciences FACSAria IIIu BD Biosciences N/A CoolLED beam-splitter DV2 Dual View Photometrics N/A CMOS camera chip OptiMOS, Qimaging N/A DEAE-Sephadex A-25 columns Cytiva Cat# 17017001 DynaMag -2 Invitrogen Cat# 12321D Gel Doc MP Imaging System BioRad N/A Hamilton TLC syringe Sigma-Aldrich Cat# HAM7635-01-1EA Immobilion -P Transfer Membrane (0.45mm pore size) Merck Cat# IPVH00010 Inject -F syringe Braun Cat# 9166017V Leica DMI 3000 B inverted fluorescent microscope Leica N/A Leica SP8 inverted microscope Leica N/A Nikon Eclipse Ts2R microscope Nikon N/A Sheep-anti-rat IgG Dynabeads Invitrogen Cat# 110-35 StepOnePlus RT PCR system Applied Biosystems N/A Tecan Spark 10M microplate reader Tecan N/A Tissue culture-treated dishes Corning Cat# 430167 Tissue culture-treated dishes (60mm) Corning Cat# 430166 Transwell filters (0.4mm pore size) Corning Cat# 3413 (Continued on next page) Developmental Cell 59, 1–18.e1–e11, February 5, 2024 e5 .. REAGENT or RESOURCE SOURCE IDENTIFIER Tri-Carb 2100TR Liquid Scintillation Counter Packard Instruments Cat# 2000CA ULTIMA GOLD scintillation liquid PerkinElmer Cat# 6013326 UltraComp eBeads Plus Compensation Beads Invitrogen Cat# 01-3333-42 Zeiss Stemi 508 Zeiss N/A

    Suspension:

    Article Title: Human conjunctiva organoids to study ocular surface homeostasis and disease.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER BSA MP biomedicals 160069 Triton X-100 Sigma-Aldrich X100-100ML Pertex Klinipath AM-08010 pSpCas9(BB)-2A-GFP gRNA cloning reagents Ran et al.90 N/A BTXpress solution BTX 45-0805 DTT Sigma Aldrich D0632 Lysyl endopeptidase (Lys C) Wako Chemicals GmbH 129-05061 Reversed-phase C18 1cc columns Waters Corporation WAT054925 Trypsin Sigma Aldrich T1426 Fibrin TISSEEL Baxter 1506079 Critical Commercial Assays RNeasy Mini Kit QIAGEN 74104 QIAquick PCR Purification Kit QIAGEN 28104 Quick-DNA Microprep kit Zymogen ZY-D3020 Chromium 3’ Gene Expression solution v3.1 10x Genomics PN-120237 TruSeq Stranded mRNA kit Illumina N/A pJet cloning kit Thermo Fisher scientific K1232 Miniprep DNA isolation kit Thermo Fisher scientific K210003 Midiprep DNA isolation kit Thermo Fisher scientific K210005 Micro BCA Protein Assay Kit Bio-Rad 23235 4-15% Mini-PROTEAN precast protein gel 10-well 30 mL Bio-Rad 4561083 ECL Prime Western blotting detection reagent GE Healthcare Life Sciences RPN2232 Deposited Data Raw and processed mouse conjunctiva bulk mRNA sequencing data This paper GEO: GSE205926 Raw and processed human conjunctiva single-cell mRNA sequencing data This paper GEO: GSE242382 Raw and processed human conjunctiva infected with HSV1 and hAdV8 bulk mRNA sequencing data This paper GEO: GSE205925 Processed human lung single-cell atlas Travaglini et al.91 https://www.synapse.org/ #!Synapse:syn21041850 Processed human gut single-cell atlas: epithelial cells Elmentaite et al.92 https://www.gutcellatlas.org/ Processed human stomach single-cell atlas Kumar et al.93 GEO: GSE183904 Pterygium and healthy conjunctiva bulk mRNA sequencing data Wolf et al.23 GEO: GSE155776 Raw conjunctival secretome data This paper ProteomeXchange: PXD043550 Compiled code used for human single-cell RNA sequencing analysis This paper https://github.com/MarieBannier/ Conjunctiva Seurat objects of human conjunctiva single-cell RNA sequencing This paper Zenodo: 8403667 Experimental Models: Organisms/Strains C57BL/6 mice Hubrecht Institute N/A NOD Scid Gamma (NSG) mice Hubrecht Institute N/A HSV1-tdTomato Etienne et al.52 N/A hAdV8 This paper N/A SARS-CoV-2 (ancestral strain, 614G) EVAg 026V-03883 SARS-CoV-2 (Delta variant) GenBank OM287123 (Continued on next page) e3 Cell Stem Cell 31, 1–17.e1–e12, February 1, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER Oligonucleotides qPCR primers This paper, Bannier-Hélaou€et et al.,81 and Table S7 N/A Viral titer primers This paper, Corman et al.,94 Lõhmussaar et al.,87 Miura-Ochiai et al.,95 and Table S7 N/A Pax6 KO primers Bannier-Hélaou€et et al.81 and Table S7 N/A Software and Algorithms CFX manager software Bio-Rad N/A Seurat v3 and v4 Stuart et al. and Hao et al.96,97 https://satijalab.org/seurat/index.html Samtools v1.10 Li98 http://www.htslib.org/ umi_tools v1.1.1 Smith et al.99 https://github.com/CGATOxford/UMI-tools CellRanger v7.1.0 10x genomics https://support.10xgenomics.com/ single-cell-gene-expression/software/ pipelines/latest/installation Souporcell Heaton et al.100 https://github.com/wheaton5/souporcell DESeq2 v1.26.0 Love et al.101 https://github.com/mikelove/DESeq2 Goseq Young et al.102 https://rdrr.io/github/nadiadavidson/goseq/ clusterProfiler v3.14.0 Yu et al.103 https://github.com/YuLab-SMU/clusterProfiler ChIPpeakAnno v3.20.0 Zhu et al.104 https://rdrr.io/bioc/ChIPpeakAnno/man/ Python Python https://www.python.org/ R version 4.1.0 R Core https://www.r-project.org/ Rstudio Rstudio https://rstudio.com/ MaxQuant v2.4.2.0 MaxQuant https://www.maxquant.org/ Uniprot human database Uniprot https://www.uniprot.org/ Perseus v1.6.15.0 Max Planck Institute of Biochemistry https://maxquant.net/perseus/ GraphPad PRISM 9 GraphPad N/A Las X Leica N/A Adobe illustrator Adobe inc. N/A Fiji NIH, Fiji developers https://imagej.net/Fiji Other EVOS FL Auto 2 Cell Imaging System Thermo Fisher scientific N/A ImageQuant LAS 4000 ECL western blot imager GE Healthcare Life Sciences N/A LSM700 confocal microscope Zeiss N/A SP8 confocal microscope Leica N/A SP8X confocal microscope Leica N/A DM4000 Leica N/A NEPA21 electroporator Nepagene N/A Ultramicrotome Ultracut Leica N/A Tecnai T12 electron microscope Thermo Fisher scientific N/A Eagle 4k*4k CCD camera Thermo Fisher scientific N/A NovaSeq6000 Illumina N/A CFX384 Touch Real-Time PCR detection system Bio-Rad N/A Spark multimode microplate reader Tecan N/A 12-well suspension plates Greiner 665102 24-well suspension plates Greiner 662102 (Continued on next page) Cell Stem Cell 31, 1–17.e1–e12, February 1, 2024 e4 .. REAGENT or RESOURCE SOURCE IDENTIFIER Thincert cell culture insert for 24 well plates Greiner 662630 Orbitrap Eclipse Tribrid Mass Spectrometer Thermo Fisher scientific N/A Vanquish Neo UHPLC System Thermo Fisher scientific N/A Easy-Spray PepMap Neo 2 mm C18 75 mm X 500 mm Thermo Fisher scientific ES75500PN FACSFusion BD Biosciences N/A FACSAria BD Biosciences N/A FACSJazz BD Biosciences N/A

    other:

    Article Title: Beyond antibiotic resistance: The whiB7 transcription factor coordinates an adaptive response to alanine starvation in mycobacteria.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER plRL293 (plNP688) M. smegmatis whiB7 driven by Mtb regulatory region (+500 bp) with His22fs delG mutation in uORF used in M. smegmatis for Figures S4C and S4D This study https://benchling.com/s/seq- gJKRIhRdHgzMIiD6GPeL?m= slm-lofzbUxFg7018X3ZCi4U plRL294 (plNP689) M. smegmatis whiB7 driven by Mtb regulatory region (+500 bp) with His22ProPro mutation in uORF used in M. smegmatis for Figures S4C and S4D This study https://benchling.com/s/seq- B8dUoil9DphongRVKHeX?m= slm-vSbXazg2ubnQcyiZ1vSC plRL295 (plNP690) M. smegmatis whiB7 driven by Mtb regulatory region (+500 bp) with Val1Gly start lost uORF mutation in uORF used in M. smegmatis for Figures S4C and S4D This study https://benchling.com/s/seq- lgrqU4siiz9Vu3gnapEi?m=slmL9pSJKkjCOFmWvnoGPoJ plRL296 (plNP691) M. smegmatis whiB7 driven by Mtb regulatory region (+500 bp) with His22fs (insCTAT) mutation in uORF used in M. smegmatis for Figures S4C and S4D This study https://benchling.com/s/seq- zOy0ar8rwDLYOYhx33fo?m= slm-Wy14qhxXIg2IGvTmDtw3 plRL62 Tweety integrase suicide vector used in M. smegmatis for Figures 1A–1F, S1A, 2A, S2C–S2F, 3A, 3B, 3E, 3F, S4A–S4C This study https://benchling.com/s/seq- LtN3e9WbixCmPd0VOCAa plRL40 Giles integrase suicide vector used in M. tuberculosis for Figures 1F, S1B, S2E, 3A, and 3C This study https://benchling.com/s/seq- 2PVXvHq0CfNPVacwz1Ku plRL19 (plJR1949) L5 integrase suicide vector used in M. smegmatais and M. tuberculosis for Figures 1C, 1E, S2A–S2F, 3A, 3F, S4B, 4C, 4D, S5A–S5C, and 5A–5D Bosch et al.30 Addgene Cat# 163634 plRL58 CRISPRi plasmid M. tuberculosis KD experiments (co-transformed with plRL19) Bosch et al.30 Addgene Cat# 166886 plRL61 CRISPRi plasmid M. smegmatis KD experiments (co-transformed with plRL19) Bosch et al.30 Addgene Cat# 163633 Software and algorithms ChemiDoc imaging system BioRad Cat# 12003153 Prism 9 GraphPad https://www.graphpad.com/features Python Python software foundation https://www.python.org/downloads/ Rstan (version 2.19.3) Stan Development Team, 2020 https://mc-stan.org/users/ interfaces/rstan.html SciPy (version 1.2.2) Virtanen et al.51 https://scipy.org/install/ Stan (version 2.19.3) Stan Development Team, 2021 https://mc-stan.org/users/interfaces/ statsmodels (version 0.10.1) Seabold and Perktold52 https://www.statsmodels.org/stable/ install.html Subread aligner (version 1.6.0) Liao et al.53 https://sourceforge.net/projects/ subread/files/subread-2.0.6// Spark Plate reader Tecan https://lifesciences.tecan.com/ QuantStudioTM 5 qPCR system Thermo Fisher Cat# A28140 Vulnerability analysis pipeline (original code) This paper and Bosch et al.30 Github: https://github.com/rocklab/whiB7KO_screen_2023/and https://doi.org/10.5281/zenodo.

    Article Title: Poxvirus A51R proteins regulate microtubule stability and antagonize a cell-intrinsic antiviral response.
    Article Snippet: : Tni ovarian cells (female) Expression Systems 94–002 Experimental models: Organisms/strains Mouse: BALB/c UFMG central animal facility N/A Oligonucleotides See Table S1 for oligonucleotides used in this study Table S1 N/A Recombinant DNA Plasmid: Flag-A51R pcDNA3 Gammon et al.21 N/A Plasmid: Flag-A51R R275A pcDNA3 This paper N/A Plasmid: Flag-A51R K295A pcDNA3 This paper N/A Plasmid: Flag-A51R K302A pcDNA3 This paper N/A Plasmid: Flag-A51R R275A/K295A/K302A pcDNA3 This paper N/A Plasmid: pET22b Sigma 69744 Plasmid: His-A51R pET22b This paper N/A Plasmid: His-mCherry pET22b This paper N/A Plasmid: His-A51R R275A/K295A/K302A pET22b This paper N/A Plasmid: CPXV (strain Brighton) His-A51R pET22b This paper N/A Plasmid: ECTV (strain Moscow) His-A51R pET22b This paper N/A Plasmid: YLDV (strain Davis) His-A51R pET22b This paper N/A Plasmid: SPXV (strain Nebraska) His-A51R pET22b This paper N/A Plasmid: pA51RFREV Gammon et al.21 N/A Plasmid: mCherry-C1 Novopro V011976 Software and algorithms ImageJ v1.51n NIH https://imagej.nih.gov/ij/ Image Studio v5.2 LI-COR Biosciences https://www.licor.com/bio/image-studio-lite/ CellSens Imaging Software v1.18 Olympus N/A FlowJo Tree Star Inc N/A Bio-Rad Image Lab Software, v5.2.1 Bio-Rad N/A Biorender Biorender https://www.biorender.com

    Enzyme-linked Immunosorbent Assay:

    Article Title: Adipocyte PI3K links adipostasis with baseline insulin secretion at fasting through an adipoincretin effect.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies AKT Phospho (Thr308) Cell Signaling 4056; RRID: AB_331163 AKT Phospho (Ser373) XP Cell Signaling 4060; RRID: AB_2315049 AKT Cell Signaling 9272; RRID: AB_329827 Erk 1/2 (p44/42 MAPK) Phospho(Thr202/Tyr204) XP Cell Signaling 9101; RRID: AB_331646 Erk 1/2 (p44/42 MAPK) Cell Signaling 9102; RRID: AB_330744 IRS1 Millipore 06248; RRID: AB_2127890 IRS2 Millipore MABS15; RRID: AB_1121131 PI3K p85 Cell Signaling 4257; RRID: AB_659889 PI3K p85a Abcam Ab133595 PI3K p55g Abcam Ab238509 Tubulin a/b Cell Signaling 2148; RRID: AB_2288042 PI3Ka Cell Signaling 4249; RRID: AB_2165248 PI3Kb Cell Signaling 3011; RRID: AB_2165246 PI3Kd Millipore 04–401; RRID: AB_673111 PI3Kg a gift of Prof. Matthias Wymann University of Basel (Russian) HSL Phospho (Ser563) Cell Signaling 4139; RRID: AB_2135495 HSL Phospho (Ser660) Cell Signaling 4126; RRID: AB_490997 HSL Phospho (Ser565) Cell Signaling 4137; RRID: AB_2135498 HSL Cell Signaling 4107; RRID: AB_2296900 Chemicals, peptides, and recombinant proteins Insulin Humalog Lilly VL7510 Glucose Acros 410955000 BSA Fisher Scientific BP9702 ECL-anti rabbit IgG HRP GE Healthcare NA934V ECL-anti mouse IgG HRP GE Healthcare LNA931V Collagenase P Roche 11213865001 GSK2636771 (Inhibitor PI3Kb) SelleckChem S8002 TGX-221 (Inhibitor PI3Kb) MedChem Express HY-10114 IPI549 (Inhibitor PI3Kg) MedChem Express(SelleckChem) HY-100716 PIK294 (Inhibitor PI3Kd) MedChem Express HY-10303 Buparlisib (BKM120, panPI3K inhibitor) MedChem Express HY-70063 Taselisib (GDC-0032, panPI3K inhibitor) MedChem Express HY-13898 Nicotinic Acid Sigma 72309 Atglistatin MedChem Express HY-15859 Cremophor EL Millipore 238470 CL 316,243 Sigma C5976 Critical commercial assays Insulin ELISA Kit Crystal Chem 90080 C-peptide Elisa Kit Crystal Chem 90050 FFA (NEFA-HR set) Fuji Film 436-91995, 434-91795 91096 (standard) Leptin Elisa Kit R&D MOB00B (Continued on next page) Cell Reports 43, 114132, May 28, 2024 17 .. REAGENT or RESOURCE SOURCE IDENTIFIER Adipsin Elisa Kit R&D DY5430-05 FABP4 Elisa Kit BioVendor RD191036200R Asprosin Elisa Kit Abbexa abx585287 Adrenaline Elisa Kit LDN BA E 5100R Corticosterone Elisa Kit IDS AC-14F1 Glucagon Elisa Kit Crystal Chem 81518 Mouse Growth factor Elisa Kit Crystal Chem 80587 Glycerol Assay Kit Sigma-Aldrich MAK117 b-Hydroxybutyrate Assay Kit Sigma-Aldrich MAK041 Immobilon Western Chemiluminescence HRP substrate Millipore WBKLS0500 Hematoxylin Solution (Mayer’s, Modified) Abcam AB220365 Eosin Sigma HT110116 Deposited data Immunoblots images This paper https://doi.org/10.17632/tgsgkjz28w.1 Experimental models: Organisms/strains WT C57BL/6 background Janvier Labs PI3KaF/F Mixed background Provided by Victoria Rotter Sopasakis PI3KaAdQ Mixed background Provided by Victoria Rotter Sopasakis Software and algorithms Image Lab software (version 5.2.1) Bio-Rad http://www.bio-rad.com/en-us/ product/image-lab-software Graph Pad Prism 7.0 Graph Pad Software N/A AxioVision Software Imaging Sofware Carl Zeiss Microscopy ..

    Modification:

    Article Title: Adipocyte PI3K links adipostasis with baseline insulin secretion at fasting through an adipoincretin effect.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies AKT Phospho (Thr308) Cell Signaling 4056; RRID: AB_331163 AKT Phospho (Ser373) XP Cell Signaling 4060; RRID: AB_2315049 AKT Cell Signaling 9272; RRID: AB_329827 Erk 1/2 (p44/42 MAPK) Phospho(Thr202/Tyr204) XP Cell Signaling 9101; RRID: AB_331646 Erk 1/2 (p44/42 MAPK) Cell Signaling 9102; RRID: AB_330744 IRS1 Millipore 06248; RRID: AB_2127890 IRS2 Millipore MABS15; RRID: AB_1121131 PI3K p85 Cell Signaling 4257; RRID: AB_659889 PI3K p85a Abcam Ab133595 PI3K p55g Abcam Ab238509 Tubulin a/b Cell Signaling 2148; RRID: AB_2288042 PI3Ka Cell Signaling 4249; RRID: AB_2165248 PI3Kb Cell Signaling 3011; RRID: AB_2165246 PI3Kd Millipore 04–401; RRID: AB_673111 PI3Kg a gift of Prof. Matthias Wymann University of Basel (Russian) HSL Phospho (Ser563) Cell Signaling 4139; RRID: AB_2135495 HSL Phospho (Ser660) Cell Signaling 4126; RRID: AB_490997 HSL Phospho (Ser565) Cell Signaling 4137; RRID: AB_2135498 HSL Cell Signaling 4107; RRID: AB_2296900 Chemicals, peptides, and recombinant proteins Insulin Humalog Lilly VL7510 Glucose Acros 410955000 BSA Fisher Scientific BP9702 ECL-anti rabbit IgG HRP GE Healthcare NA934V ECL-anti mouse IgG HRP GE Healthcare LNA931V Collagenase P Roche 11213865001 GSK2636771 (Inhibitor PI3Kb) SelleckChem S8002 TGX-221 (Inhibitor PI3Kb) MedChem Express HY-10114 IPI549 (Inhibitor PI3Kg) MedChem Express(SelleckChem) HY-100716 PIK294 (Inhibitor PI3Kd) MedChem Express HY-10303 Buparlisib (BKM120, panPI3K inhibitor) MedChem Express HY-70063 Taselisib (GDC-0032, panPI3K inhibitor) MedChem Express HY-13898 Nicotinic Acid Sigma 72309 Atglistatin MedChem Express HY-15859 Cremophor EL Millipore 238470 CL 316,243 Sigma C5976 Critical commercial assays Insulin ELISA Kit Crystal Chem 90080 C-peptide Elisa Kit Crystal Chem 90050 FFA (NEFA-HR set) Fuji Film 436-91995, 434-91795 91096 (standard) Leptin Elisa Kit R&D MOB00B (Continued on next page) Cell Reports 43, 114132, May 28, 2024 17 .. REAGENT or RESOURCE SOURCE IDENTIFIER Adipsin Elisa Kit R&D DY5430-05 FABP4 Elisa Kit BioVendor RD191036200R Asprosin Elisa Kit Abbexa abx585287 Adrenaline Elisa Kit LDN BA E 5100R Corticosterone Elisa Kit IDS AC-14F1 Glucagon Elisa Kit Crystal Chem 81518 Mouse Growth factor Elisa Kit Crystal Chem 80587 Glycerol Assay Kit Sigma-Aldrich MAK117 b-Hydroxybutyrate Assay Kit Sigma-Aldrich MAK041 Immobilon Western Chemiluminescence HRP substrate Millipore WBKLS0500 Hematoxylin Solution (Mayer’s, Modified) Abcam AB220365 Eosin Sigma HT110116 Deposited data Immunoblots images This paper https://doi.org/10.17632/tgsgkjz28w.1 Experimental models: Organisms/strains WT C57BL/6 background Janvier Labs PI3KaF/F Mixed background Provided by Victoria Rotter Sopasakis PI3KaAdQ Mixed background Provided by Victoria Rotter Sopasakis Software and algorithms Image Lab software (version 5.2.1) Bio-Rad http://www.bio-rad.com/en-us/ product/image-lab-software Graph Pad Prism 7.0 Graph Pad Software N/A AxioVision Software Imaging Sofware Carl Zeiss Microscopy ..

    Quantitative RT-PCR:

    Article Title: Multi-dimensional metabolomic remodeling under diverse muscle atrophic stimuli in vivo.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER TSKgel Amide-80 (3.0 μm, 2.0 mm × 15 cm TOSOH Corporation Cat# 0021865 G266 DNA Damage Detection Kit - γH2AX - Red Dojindo Molecular Technologies Cat# 340-09431 HEPES Nacalai Tesque Cat# 02443-34 Trichloroacetic acid Nacalai Tesque Cat# 06275-24 L-Methionine sulfome Thermo Fisher Cat# A17027 Takara Taq Takara Cat# R001A Takara Ex Taq Takara Cat# RR001A Agarose for ≧1kbp fragment (Fine Powder) Nacalai Tesque Cat# 02468-95 100 bp DNA ladder One Nacalai Tesque Cat# 07908-75 6x Loading Dye Toyobo Cat# RE-DYE Ethidium Bromide Solution Nacalai Tesque Cat# 14631-94 Sodium Chloride Nacalai Tesque Cat# 31320-05 Bacto TM Peptone DIFCO Cat# 0118-17-0 Extract Yeast Dried Nacalai Tesque Cat# 15838-45 Bacto TM Agar BD Cat# 214010 Competent Quick DH5α Toyobo Cat# DNA-913 Ampicillin Sodium Salt Nacalai Tesque Cat# 02739-74 KOD-Plus-Neo Toyobo Cat# KOD-401 QIAGEN Plasmid Midi kit QIAGEN Cat# 12145 Calf intestine alkarine phosphatase Takara Cat# 2250A QIAEX II Gel Extraction Kit QIAGEN Cat# 20021 DNA Ligation Kit Ver.2.1 Takara Cat# 6022 Venoject II Terumo Cat# VP-DK051K Isoflurane Viatris – Domitor Nippon Zenyaku Kogyo – Midazolam Sandoz – Vetorphale Meiji Seika Pharma – Antisedan Nippon Zenyaku Kogyo – Deposited data Metabolomics data (Skeletal muscle, FoxO1 overexpression and immobilization, FoxO1-Tg and C57BL/6J) https://www. metabolomicsworkbench.org Metabolomics Workbench Study ID: ST003721; Project ID: PR002310 Metabolomics data (plasma, FoxO1 overexpression and immobilization, FoxO1-Tg and C57BL/6J) https://www. metabolomicsworkbench.org Metabolomics Workbench Study ID: ST003722; Project ID: PR002311 Metabolomics data (Skeletal muscle, Cancer cachexia and starvation, C57BL/6J) https://www. metabolomicsworkbench.org Metabolomics Workbench Study ID: ST003723; Project ID: PR002312 Metabolomics data (Skeletal muscle, immobilization, mFoxO1,3,4 flox/flox and mFoxO1,3,4 − /− ) https://www. metabolomicsworkbench.org Metabolomics Workbench Study ID: ST003724; Project ID: PR002313 Experimental models: Cell lines LLC cells: LL/2 (LLC1) ATCC CRL-1642 Primary myoblast This paper N/A C2C12 myoblasts Riken Cell Bank RCB0987 C2C12 myoblasts (Western blot analysis for SUnSET analysis and MG-132 experiment) ATCC CRL-1772 HEK293T cells Oyabu et al. 29 N/A Experimental models: Organisms/strains Mouse: C57BL/6J CLEA – Mouse: HSA-FOXO1-Tg Kamei Lab N/A Mouse: HSA-Cre FoxO1,3,4 flox/flox Kamei Lab N/A Mouse: HSA-DN-FOXO1-Tg Yamazaki et al. 42 N/A (Continued on next page) Cell Reports 44, 116097, August 26, 2025 19 .. REAGENT or RESOURCE SOURCE IDENTIFIER Oligonucleotides Primers for genotyping This paper Table S1 Primer for RT-qPCR This paper Table S2 MISSION siRNA Universal Negative Control #1 Sigma-Aldrich Cat# SIC001 MISSION siAmd2_1 Sigma-Aldrich Cat# SASI_Mm02_00311615 MISSION siAmd2_2 Sigma-Aldrich Cat# SASI_Mm01_00156378 Recombinant DNA pCAG-FOXO1(3A) Oyabu et al. 29 N/A pCMX-GFP Oyabu et al. 29 N/A pGL3-Odc1 promoter-luciferase This paper N/A phRL-TK Promega Cat# E2241 Software and algorithms Prism 10 software GraphPad Software – ImageJ NIH https://imagej.nih.gov/ij/download.html BZ-X800 Viewer Keyence – BZ-X800 Analyzer Keyence – ImageLab software Bio-Rad – Venn Diagrams Bioinformatics & Evolutionary Genomics http://bioinformatics.psb.ugent.be/ webtools/Venn/ Cluster 3.0 de Hoon et al. 43 http://bonsai.hgc.jp/∼mdehoon/ software/cluster/ Java TreeView Saldanha et al. 44 https://jtreeview.sourceforge.net MasterHands ver.2 software (Keio University, Tsuruoka, Yamagata, Japan) Sugimoto t al. 45 N/A MetaboAnalyst Pang et al. 46 https://www.metaboanalyst.ca/ LabSolutions LCMS Shimadzu N/A RNAseqChef Etoh and Nakao 47 https://imeg-ku.shinyapps.io/RNAseqChef/ GREIN: GEO RNA-seq Experiments Interactive Navigator Mahi et al. 48 https://www.ilincs.org/apps/grein/ SarcoAtlas Ham et al. 49 and Borsch et al. 50 https://sarcoatlas.scicore.unibas.ch Ensembl Harrison et al. 51 https://asia.ensembl.org Clustal Omega Multiple sequence Alighment (MSA) Madeira et al. 52 https://www.ebi.ac.uk/ jdispatcher/msa/clustalo R system R Core Team https://cran.r-project.org Programming environment of R: RStudio RStudio Team https://www.rstudio.com Adobe Illustrator Adobe https://www.adobe.com Excel Microsoft https://www.microsoft.com/ en-us/microsoft-365/excel BioRender: Scientific Image and Illustration Software N/A https://www.biorender.com Primer Express 2.0 Thermo Fisher – Primer-BLAST NIH https://www.ncbi.nlm.nih.gov/tools/primer- blast/https://www.ilincs.org/apps/grein/ Other Metabolomic analyses (CE-TOFMS) Human Metabolome Technologies N/A Agilent CE-TOFMS system Agilent Technologies – LCMS-8040 triple quadrupole mass spectrometer Shimadzu – Grip strength meter Melquest Cat# GPM-101B CFX Connect Real-Time PCR Detection System Bio-Rad Cat# 1855201J1 ChemiDoc XRS+ Imaging System Bio-Rad Cat# 1708265J1 (Continued on next page) 20 Cell Reports 44, 116097, August 26, 2025 ..

    Negative Control:

    Article Title: Multi-dimensional metabolomic remodeling under diverse muscle atrophic stimuli in vivo.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER TSKgel Amide-80 (3.0 μm, 2.0 mm × 15 cm TOSOH Corporation Cat# 0021865 G266 DNA Damage Detection Kit - γH2AX - Red Dojindo Molecular Technologies Cat# 340-09431 HEPES Nacalai Tesque Cat# 02443-34 Trichloroacetic acid Nacalai Tesque Cat# 06275-24 L-Methionine sulfome Thermo Fisher Cat# A17027 Takara Taq Takara Cat# R001A Takara Ex Taq Takara Cat# RR001A Agarose for ≧1kbp fragment (Fine Powder) Nacalai Tesque Cat# 02468-95 100 bp DNA ladder One Nacalai Tesque Cat# 07908-75 6x Loading Dye Toyobo Cat# RE-DYE Ethidium Bromide Solution Nacalai Tesque Cat# 14631-94 Sodium Chloride Nacalai Tesque Cat# 31320-05 Bacto TM Peptone DIFCO Cat# 0118-17-0 Extract Yeast Dried Nacalai Tesque Cat# 15838-45 Bacto TM Agar BD Cat# 214010 Competent Quick DH5α Toyobo Cat# DNA-913 Ampicillin Sodium Salt Nacalai Tesque Cat# 02739-74 KOD-Plus-Neo Toyobo Cat# KOD-401 QIAGEN Plasmid Midi kit QIAGEN Cat# 12145 Calf intestine alkarine phosphatase Takara Cat# 2250A QIAEX II Gel Extraction Kit QIAGEN Cat# 20021 DNA Ligation Kit Ver.2.1 Takara Cat# 6022 Venoject II Terumo Cat# VP-DK051K Isoflurane Viatris – Domitor Nippon Zenyaku Kogyo – Midazolam Sandoz – Vetorphale Meiji Seika Pharma – Antisedan Nippon Zenyaku Kogyo – Deposited data Metabolomics data (Skeletal muscle, FoxO1 overexpression and immobilization, FoxO1-Tg and C57BL/6J) https://www. metabolomicsworkbench.org Metabolomics Workbench Study ID: ST003721; Project ID: PR002310 Metabolomics data (plasma, FoxO1 overexpression and immobilization, FoxO1-Tg and C57BL/6J) https://www. metabolomicsworkbench.org Metabolomics Workbench Study ID: ST003722; Project ID: PR002311 Metabolomics data (Skeletal muscle, Cancer cachexia and starvation, C57BL/6J) https://www. metabolomicsworkbench.org Metabolomics Workbench Study ID: ST003723; Project ID: PR002312 Metabolomics data (Skeletal muscle, immobilization, mFoxO1,3,4 flox/flox and mFoxO1,3,4 − /− ) https://www. metabolomicsworkbench.org Metabolomics Workbench Study ID: ST003724; Project ID: PR002313 Experimental models: Cell lines LLC cells: LL/2 (LLC1) ATCC CRL-1642 Primary myoblast This paper N/A C2C12 myoblasts Riken Cell Bank RCB0987 C2C12 myoblasts (Western blot analysis for SUnSET analysis and MG-132 experiment) ATCC CRL-1772 HEK293T cells Oyabu et al. 29 N/A Experimental models: Organisms/strains Mouse: C57BL/6J CLEA – Mouse: HSA-FOXO1-Tg Kamei Lab N/A Mouse: HSA-Cre FoxO1,3,4 flox/flox Kamei Lab N/A Mouse: HSA-DN-FOXO1-Tg Yamazaki et al. 42 N/A (Continued on next page) Cell Reports 44, 116097, August 26, 2025 19 .. REAGENT or RESOURCE SOURCE IDENTIFIER Oligonucleotides Primers for genotyping This paper Table S1 Primer for RT-qPCR This paper Table S2 MISSION siRNA Universal Negative Control #1 Sigma-Aldrich Cat# SIC001 MISSION siAmd2_1 Sigma-Aldrich Cat# SASI_Mm02_00311615 MISSION siAmd2_2 Sigma-Aldrich Cat# SASI_Mm01_00156378 Recombinant DNA pCAG-FOXO1(3A) Oyabu et al. 29 N/A pCMX-GFP Oyabu et al. 29 N/A pGL3-Odc1 promoter-luciferase This paper N/A phRL-TK Promega Cat# E2241 Software and algorithms Prism 10 software GraphPad Software – ImageJ NIH https://imagej.nih.gov/ij/download.html BZ-X800 Viewer Keyence – BZ-X800 Analyzer Keyence – ImageLab software Bio-Rad – Venn Diagrams Bioinformatics & Evolutionary Genomics http://bioinformatics.psb.ugent.be/ webtools/Venn/ Cluster 3.0 de Hoon et al. 43 http://bonsai.hgc.jp/∼mdehoon/ software/cluster/ Java TreeView Saldanha et al. 44 https://jtreeview.sourceforge.net MasterHands ver.2 software (Keio University, Tsuruoka, Yamagata, Japan) Sugimoto t al. 45 N/A MetaboAnalyst Pang et al. 46 https://www.metaboanalyst.ca/ LabSolutions LCMS Shimadzu N/A RNAseqChef Etoh and Nakao 47 https://imeg-ku.shinyapps.io/RNAseqChef/ GREIN: GEO RNA-seq Experiments Interactive Navigator Mahi et al. 48 https://www.ilincs.org/apps/grein/ SarcoAtlas Ham et al. 49 and Borsch et al. 50 https://sarcoatlas.scicore.unibas.ch Ensembl Harrison et al. 51 https://asia.ensembl.org Clustal Omega Multiple sequence Alighment (MSA) Madeira et al. 52 https://www.ebi.ac.uk/ jdispatcher/msa/clustalo R system R Core Team https://cran.r-project.org Programming environment of R: RStudio RStudio Team https://www.rstudio.com Adobe Illustrator Adobe https://www.adobe.com Excel Microsoft https://www.microsoft.com/ en-us/microsoft-365/excel BioRender: Scientific Image and Illustration Software N/A https://www.biorender.com Primer Express 2.0 Thermo Fisher – Primer-BLAST NIH https://www.ncbi.nlm.nih.gov/tools/primer- blast/https://www.ilincs.org/apps/grein/ Other Metabolomic analyses (CE-TOFMS) Human Metabolome Technologies N/A Agilent CE-TOFMS system Agilent Technologies – LCMS-8040 triple quadrupole mass spectrometer Shimadzu – Grip strength meter Melquest Cat# GPM-101B CFX Connect Real-Time PCR Detection System Bio-Rad Cat# 1855201J1 ChemiDoc XRS+ Imaging System Bio-Rad Cat# 1708265J1 (Continued on next page) 20 Cell Reports 44, 116097, August 26, 2025 ..

    Recombinant:

    Article Title: Multi-dimensional metabolomic remodeling under diverse muscle atrophic stimuli in vivo.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER TSKgel Amide-80 (3.0 μm, 2.0 mm × 15 cm TOSOH Corporation Cat# 0021865 G266 DNA Damage Detection Kit - γH2AX - Red Dojindo Molecular Technologies Cat# 340-09431 HEPES Nacalai Tesque Cat# 02443-34 Trichloroacetic acid Nacalai Tesque Cat# 06275-24 L-Methionine sulfome Thermo Fisher Cat# A17027 Takara Taq Takara Cat# R001A Takara Ex Taq Takara Cat# RR001A Agarose for ≧1kbp fragment (Fine Powder) Nacalai Tesque Cat# 02468-95 100 bp DNA ladder One Nacalai Tesque Cat# 07908-75 6x Loading Dye Toyobo Cat# RE-DYE Ethidium Bromide Solution Nacalai Tesque Cat# 14631-94 Sodium Chloride Nacalai Tesque Cat# 31320-05 Bacto TM Peptone DIFCO Cat# 0118-17-0 Extract Yeast Dried Nacalai Tesque Cat# 15838-45 Bacto TM Agar BD Cat# 214010 Competent Quick DH5α Toyobo Cat# DNA-913 Ampicillin Sodium Salt Nacalai Tesque Cat# 02739-74 KOD-Plus-Neo Toyobo Cat# KOD-401 QIAGEN Plasmid Midi kit QIAGEN Cat# 12145 Calf intestine alkarine phosphatase Takara Cat# 2250A QIAEX II Gel Extraction Kit QIAGEN Cat# 20021 DNA Ligation Kit Ver.2.1 Takara Cat# 6022 Venoject II Terumo Cat# VP-DK051K Isoflurane Viatris – Domitor Nippon Zenyaku Kogyo – Midazolam Sandoz – Vetorphale Meiji Seika Pharma – Antisedan Nippon Zenyaku Kogyo – Deposited data Metabolomics data (Skeletal muscle, FoxO1 overexpression and immobilization, FoxO1-Tg and C57BL/6J) https://www. metabolomicsworkbench.org Metabolomics Workbench Study ID: ST003721; Project ID: PR002310 Metabolomics data (plasma, FoxO1 overexpression and immobilization, FoxO1-Tg and C57BL/6J) https://www. metabolomicsworkbench.org Metabolomics Workbench Study ID: ST003722; Project ID: PR002311 Metabolomics data (Skeletal muscle, Cancer cachexia and starvation, C57BL/6J) https://www. metabolomicsworkbench.org Metabolomics Workbench Study ID: ST003723; Project ID: PR002312 Metabolomics data (Skeletal muscle, immobilization, mFoxO1,3,4 flox/flox and mFoxO1,3,4 − /− ) https://www. metabolomicsworkbench.org Metabolomics Workbench Study ID: ST003724; Project ID: PR002313 Experimental models: Cell lines LLC cells: LL/2 (LLC1) ATCC CRL-1642 Primary myoblast This paper N/A C2C12 myoblasts Riken Cell Bank RCB0987 C2C12 myoblasts (Western blot analysis for SUnSET analysis and MG-132 experiment) ATCC CRL-1772 HEK293T cells Oyabu et al. 29 N/A Experimental models: Organisms/strains Mouse: C57BL/6J CLEA – Mouse: HSA-FOXO1-Tg Kamei Lab N/A Mouse: HSA-Cre FoxO1,3,4 flox/flox Kamei Lab N/A Mouse: HSA-DN-FOXO1-Tg Yamazaki et al. 42 N/A (Continued on next page) Cell Reports 44, 116097, August 26, 2025 19 .. REAGENT or RESOURCE SOURCE IDENTIFIER Oligonucleotides Primers for genotyping This paper Table S1 Primer for RT-qPCR This paper Table S2 MISSION siRNA Universal Negative Control #1 Sigma-Aldrich Cat# SIC001 MISSION siAmd2_1 Sigma-Aldrich Cat# SASI_Mm02_00311615 MISSION siAmd2_2 Sigma-Aldrich Cat# SASI_Mm01_00156378 Recombinant DNA pCAG-FOXO1(3A) Oyabu et al. 29 N/A pCMX-GFP Oyabu et al. 29 N/A pGL3-Odc1 promoter-luciferase This paper N/A phRL-TK Promega Cat# E2241 Software and algorithms Prism 10 software GraphPad Software – ImageJ NIH https://imagej.nih.gov/ij/download.html BZ-X800 Viewer Keyence – BZ-X800 Analyzer Keyence – ImageLab software Bio-Rad – Venn Diagrams Bioinformatics & Evolutionary Genomics http://bioinformatics.psb.ugent.be/ webtools/Venn/ Cluster 3.0 de Hoon et al. 43 http://bonsai.hgc.jp/∼mdehoon/ software/cluster/ Java TreeView Saldanha et al. 44 https://jtreeview.sourceforge.net MasterHands ver.2 software (Keio University, Tsuruoka, Yamagata, Japan) Sugimoto t al. 45 N/A MetaboAnalyst Pang et al. 46 https://www.metaboanalyst.ca/ LabSolutions LCMS Shimadzu N/A RNAseqChef Etoh and Nakao 47 https://imeg-ku.shinyapps.io/RNAseqChef/ GREIN: GEO RNA-seq Experiments Interactive Navigator Mahi et al. 48 https://www.ilincs.org/apps/grein/ SarcoAtlas Ham et al. 49 and Borsch et al. 50 https://sarcoatlas.scicore.unibas.ch Ensembl Harrison et al. 51 https://asia.ensembl.org Clustal Omega Multiple sequence Alighment (MSA) Madeira et al. 52 https://www.ebi.ac.uk/ jdispatcher/msa/clustalo R system R Core Team https://cran.r-project.org Programming environment of R: RStudio RStudio Team https://www.rstudio.com Adobe Illustrator Adobe https://www.adobe.com Excel Microsoft https://www.microsoft.com/ en-us/microsoft-365/excel BioRender: Scientific Image and Illustration Software N/A https://www.biorender.com Primer Express 2.0 Thermo Fisher – Primer-BLAST NIH https://www.ncbi.nlm.nih.gov/tools/primer- blast/https://www.ilincs.org/apps/grein/ Other Metabolomic analyses (CE-TOFMS) Human Metabolome Technologies N/A Agilent CE-TOFMS system Agilent Technologies – LCMS-8040 triple quadrupole mass spectrometer Shimadzu – Grip strength meter Melquest Cat# GPM-101B CFX Connect Real-Time PCR Detection System Bio-Rad Cat# 1855201J1 ChemiDoc XRS+ Imaging System Bio-Rad Cat# 1708265J1 (Continued on next page) 20 Cell Reports 44, 116097, August 26, 2025 ..

    Liquid Chromatography with Mass Spectroscopy:

    Article Title: Multi-dimensional metabolomic remodeling under diverse muscle atrophic stimuli in vivo.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER TSKgel Amide-80 (3.0 μm, 2.0 mm × 15 cm TOSOH Corporation Cat# 0021865 G266 DNA Damage Detection Kit - γH2AX - Red Dojindo Molecular Technologies Cat# 340-09431 HEPES Nacalai Tesque Cat# 02443-34 Trichloroacetic acid Nacalai Tesque Cat# 06275-24 L-Methionine sulfome Thermo Fisher Cat# A17027 Takara Taq Takara Cat# R001A Takara Ex Taq Takara Cat# RR001A Agarose for ≧1kbp fragment (Fine Powder) Nacalai Tesque Cat# 02468-95 100 bp DNA ladder One Nacalai Tesque Cat# 07908-75 6x Loading Dye Toyobo Cat# RE-DYE Ethidium Bromide Solution Nacalai Tesque Cat# 14631-94 Sodium Chloride Nacalai Tesque Cat# 31320-05 Bacto TM Peptone DIFCO Cat# 0118-17-0 Extract Yeast Dried Nacalai Tesque Cat# 15838-45 Bacto TM Agar BD Cat# 214010 Competent Quick DH5α Toyobo Cat# DNA-913 Ampicillin Sodium Salt Nacalai Tesque Cat# 02739-74 KOD-Plus-Neo Toyobo Cat# KOD-401 QIAGEN Plasmid Midi kit QIAGEN Cat# 12145 Calf intestine alkarine phosphatase Takara Cat# 2250A QIAEX II Gel Extraction Kit QIAGEN Cat# 20021 DNA Ligation Kit Ver.2.1 Takara Cat# 6022 Venoject II Terumo Cat# VP-DK051K Isoflurane Viatris – Domitor Nippon Zenyaku Kogyo – Midazolam Sandoz – Vetorphale Meiji Seika Pharma – Antisedan Nippon Zenyaku Kogyo – Deposited data Metabolomics data (Skeletal muscle, FoxO1 overexpression and immobilization, FoxO1-Tg and C57BL/6J) https://www. metabolomicsworkbench.org Metabolomics Workbench Study ID: ST003721; Project ID: PR002310 Metabolomics data (plasma, FoxO1 overexpression and immobilization, FoxO1-Tg and C57BL/6J) https://www. metabolomicsworkbench.org Metabolomics Workbench Study ID: ST003722; Project ID: PR002311 Metabolomics data (Skeletal muscle, Cancer cachexia and starvation, C57BL/6J) https://www. metabolomicsworkbench.org Metabolomics Workbench Study ID: ST003723; Project ID: PR002312 Metabolomics data (Skeletal muscle, immobilization, mFoxO1,3,4 flox/flox and mFoxO1,3,4 − /− ) https://www. metabolomicsworkbench.org Metabolomics Workbench Study ID: ST003724; Project ID: PR002313 Experimental models: Cell lines LLC cells: LL/2 (LLC1) ATCC CRL-1642 Primary myoblast This paper N/A C2C12 myoblasts Riken Cell Bank RCB0987 C2C12 myoblasts (Western blot analysis for SUnSET analysis and MG-132 experiment) ATCC CRL-1772 HEK293T cells Oyabu et al. 29 N/A Experimental models: Organisms/strains Mouse: C57BL/6J CLEA – Mouse: HSA-FOXO1-Tg Kamei Lab N/A Mouse: HSA-Cre FoxO1,3,4 flox/flox Kamei Lab N/A Mouse: HSA-DN-FOXO1-Tg Yamazaki et al. 42 N/A (Continued on next page) Cell Reports 44, 116097, August 26, 2025 19 .. REAGENT or RESOURCE SOURCE IDENTIFIER Oligonucleotides Primers for genotyping This paper Table S1 Primer for RT-qPCR This paper Table S2 MISSION siRNA Universal Negative Control #1 Sigma-Aldrich Cat# SIC001 MISSION siAmd2_1 Sigma-Aldrich Cat# SASI_Mm02_00311615 MISSION siAmd2_2 Sigma-Aldrich Cat# SASI_Mm01_00156378 Recombinant DNA pCAG-FOXO1(3A) Oyabu et al. 29 N/A pCMX-GFP Oyabu et al. 29 N/A pGL3-Odc1 promoter-luciferase This paper N/A phRL-TK Promega Cat# E2241 Software and algorithms Prism 10 software GraphPad Software – ImageJ NIH https://imagej.nih.gov/ij/download.html BZ-X800 Viewer Keyence – BZ-X800 Analyzer Keyence – ImageLab software Bio-Rad – Venn Diagrams Bioinformatics & Evolutionary Genomics http://bioinformatics.psb.ugent.be/ webtools/Venn/ Cluster 3.0 de Hoon et al. 43 http://bonsai.hgc.jp/∼mdehoon/ software/cluster/ Java TreeView Saldanha et al. 44 https://jtreeview.sourceforge.net MasterHands ver.2 software (Keio University, Tsuruoka, Yamagata, Japan) Sugimoto t al. 45 N/A MetaboAnalyst Pang et al. 46 https://www.metaboanalyst.ca/ LabSolutions LCMS Shimadzu N/A RNAseqChef Etoh and Nakao 47 https://imeg-ku.shinyapps.io/RNAseqChef/ GREIN: GEO RNA-seq Experiments Interactive Navigator Mahi et al. 48 https://www.ilincs.org/apps/grein/ SarcoAtlas Ham et al. 49 and Borsch et al. 50 https://sarcoatlas.scicore.unibas.ch Ensembl Harrison et al. 51 https://asia.ensembl.org Clustal Omega Multiple sequence Alighment (MSA) Madeira et al. 52 https://www.ebi.ac.uk/ jdispatcher/msa/clustalo R system R Core Team https://cran.r-project.org Programming environment of R: RStudio RStudio Team https://www.rstudio.com Adobe Illustrator Adobe https://www.adobe.com Excel Microsoft https://www.microsoft.com/ en-us/microsoft-365/excel BioRender: Scientific Image and Illustration Software N/A https://www.biorender.com Primer Express 2.0 Thermo Fisher – Primer-BLAST NIH https://www.ncbi.nlm.nih.gov/tools/primer- blast/https://www.ilincs.org/apps/grein/ Other Metabolomic analyses (CE-TOFMS) Human Metabolome Technologies N/A Agilent CE-TOFMS system Agilent Technologies – LCMS-8040 triple quadrupole mass spectrometer Shimadzu – Grip strength meter Melquest Cat# GPM-101B CFX Connect Real-Time PCR Detection System Bio-Rad Cat# 1855201J1 ChemiDoc XRS+ Imaging System Bio-Rad Cat# 1708265J1 (Continued on next page) 20 Cell Reports 44, 116097, August 26, 2025 ..

    RNA Sequencing:

    Article Title: Multi-dimensional metabolomic remodeling under diverse muscle atrophic stimuli in vivo.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER TSKgel Amide-80 (3.0 μm, 2.0 mm × 15 cm TOSOH Corporation Cat# 0021865 G266 DNA Damage Detection Kit - γH2AX - Red Dojindo Molecular Technologies Cat# 340-09431 HEPES Nacalai Tesque Cat# 02443-34 Trichloroacetic acid Nacalai Tesque Cat# 06275-24 L-Methionine sulfome Thermo Fisher Cat# A17027 Takara Taq Takara Cat# R001A Takara Ex Taq Takara Cat# RR001A Agarose for ≧1kbp fragment (Fine Powder) Nacalai Tesque Cat# 02468-95 100 bp DNA ladder One Nacalai Tesque Cat# 07908-75 6x Loading Dye Toyobo Cat# RE-DYE Ethidium Bromide Solution Nacalai Tesque Cat# 14631-94 Sodium Chloride Nacalai Tesque Cat# 31320-05 Bacto TM Peptone DIFCO Cat# 0118-17-0 Extract Yeast Dried Nacalai Tesque Cat# 15838-45 Bacto TM Agar BD Cat# 214010 Competent Quick DH5α Toyobo Cat# DNA-913 Ampicillin Sodium Salt Nacalai Tesque Cat# 02739-74 KOD-Plus-Neo Toyobo Cat# KOD-401 QIAGEN Plasmid Midi kit QIAGEN Cat# 12145 Calf intestine alkarine phosphatase Takara Cat# 2250A QIAEX II Gel Extraction Kit QIAGEN Cat# 20021 DNA Ligation Kit Ver.2.1 Takara Cat# 6022 Venoject II Terumo Cat# VP-DK051K Isoflurane Viatris – Domitor Nippon Zenyaku Kogyo – Midazolam Sandoz – Vetorphale Meiji Seika Pharma – Antisedan Nippon Zenyaku Kogyo – Deposited data Metabolomics data (Skeletal muscle, FoxO1 overexpression and immobilization, FoxO1-Tg and C57BL/6J) https://www. metabolomicsworkbench.org Metabolomics Workbench Study ID: ST003721; Project ID: PR002310 Metabolomics data (plasma, FoxO1 overexpression and immobilization, FoxO1-Tg and C57BL/6J) https://www. metabolomicsworkbench.org Metabolomics Workbench Study ID: ST003722; Project ID: PR002311 Metabolomics data (Skeletal muscle, Cancer cachexia and starvation, C57BL/6J) https://www. metabolomicsworkbench.org Metabolomics Workbench Study ID: ST003723; Project ID: PR002312 Metabolomics data (Skeletal muscle, immobilization, mFoxO1,3,4 flox/flox and mFoxO1,3,4 − /− ) https://www. metabolomicsworkbench.org Metabolomics Workbench Study ID: ST003724; Project ID: PR002313 Experimental models: Cell lines LLC cells: LL/2 (LLC1) ATCC CRL-1642 Primary myoblast This paper N/A C2C12 myoblasts Riken Cell Bank RCB0987 C2C12 myoblasts (Western blot analysis for SUnSET analysis and MG-132 experiment) ATCC CRL-1772 HEK293T cells Oyabu et al. 29 N/A Experimental models: Organisms/strains Mouse: C57BL/6J CLEA – Mouse: HSA-FOXO1-Tg Kamei Lab N/A Mouse: HSA-Cre FoxO1,3,4 flox/flox Kamei Lab N/A Mouse: HSA-DN-FOXO1-Tg Yamazaki et al. 42 N/A (Continued on next page) Cell Reports 44, 116097, August 26, 2025 19 .. REAGENT or RESOURCE SOURCE IDENTIFIER Oligonucleotides Primers for genotyping This paper Table S1 Primer for RT-qPCR This paper Table S2 MISSION siRNA Universal Negative Control #1 Sigma-Aldrich Cat# SIC001 MISSION siAmd2_1 Sigma-Aldrich Cat# SASI_Mm02_00311615 MISSION siAmd2_2 Sigma-Aldrich Cat# SASI_Mm01_00156378 Recombinant DNA pCAG-FOXO1(3A) Oyabu et al. 29 N/A pCMX-GFP Oyabu et al. 29 N/A pGL3-Odc1 promoter-luciferase This paper N/A phRL-TK Promega Cat# E2241 Software and algorithms Prism 10 software GraphPad Software – ImageJ NIH https://imagej.nih.gov/ij/download.html BZ-X800 Viewer Keyence – BZ-X800 Analyzer Keyence – ImageLab software Bio-Rad – Venn Diagrams Bioinformatics & Evolutionary Genomics http://bioinformatics.psb.ugent.be/ webtools/Venn/ Cluster 3.0 de Hoon et al. 43 http://bonsai.hgc.jp/∼mdehoon/ software/cluster/ Java TreeView Saldanha et al. 44 https://jtreeview.sourceforge.net MasterHands ver.2 software (Keio University, Tsuruoka, Yamagata, Japan) Sugimoto t al. 45 N/A MetaboAnalyst Pang et al. 46 https://www.metaboanalyst.ca/ LabSolutions LCMS Shimadzu N/A RNAseqChef Etoh and Nakao 47 https://imeg-ku.shinyapps.io/RNAseqChef/ GREIN: GEO RNA-seq Experiments Interactive Navigator Mahi et al. 48 https://www.ilincs.org/apps/grein/ SarcoAtlas Ham et al. 49 and Borsch et al. 50 https://sarcoatlas.scicore.unibas.ch Ensembl Harrison et al. 51 https://asia.ensembl.org Clustal Omega Multiple sequence Alighment (MSA) Madeira et al. 52 https://www.ebi.ac.uk/ jdispatcher/msa/clustalo R system R Core Team https://cran.r-project.org Programming environment of R: RStudio RStudio Team https://www.rstudio.com Adobe Illustrator Adobe https://www.adobe.com Excel Microsoft https://www.microsoft.com/ en-us/microsoft-365/excel BioRender: Scientific Image and Illustration Software N/A https://www.biorender.com Primer Express 2.0 Thermo Fisher – Primer-BLAST NIH https://www.ncbi.nlm.nih.gov/tools/primer- blast/https://www.ilincs.org/apps/grein/ Other Metabolomic analyses (CE-TOFMS) Human Metabolome Technologies N/A Agilent CE-TOFMS system Agilent Technologies – LCMS-8040 triple quadrupole mass spectrometer Shimadzu – Grip strength meter Melquest Cat# GPM-101B CFX Connect Real-Time PCR Detection System Bio-Rad Cat# 1855201J1 ChemiDoc XRS+ Imaging System Bio-Rad Cat# 1708265J1 (Continued on next page) 20 Cell Reports 44, 116097, August 26, 2025 ..

    Sequencing:

    Article Title: Multi-dimensional metabolomic remodeling under diverse muscle atrophic stimuli in vivo.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER TSKgel Amide-80 (3.0 μm, 2.0 mm × 15 cm TOSOH Corporation Cat# 0021865 G266 DNA Damage Detection Kit - γH2AX - Red Dojindo Molecular Technologies Cat# 340-09431 HEPES Nacalai Tesque Cat# 02443-34 Trichloroacetic acid Nacalai Tesque Cat# 06275-24 L-Methionine sulfome Thermo Fisher Cat# A17027 Takara Taq Takara Cat# R001A Takara Ex Taq Takara Cat# RR001A Agarose for ≧1kbp fragment (Fine Powder) Nacalai Tesque Cat# 02468-95 100 bp DNA ladder One Nacalai Tesque Cat# 07908-75 6x Loading Dye Toyobo Cat# RE-DYE Ethidium Bromide Solution Nacalai Tesque Cat# 14631-94 Sodium Chloride Nacalai Tesque Cat# 31320-05 Bacto TM Peptone DIFCO Cat# 0118-17-0 Extract Yeast Dried Nacalai Tesque Cat# 15838-45 Bacto TM Agar BD Cat# 214010 Competent Quick DH5α Toyobo Cat# DNA-913 Ampicillin Sodium Salt Nacalai Tesque Cat# 02739-74 KOD-Plus-Neo Toyobo Cat# KOD-401 QIAGEN Plasmid Midi kit QIAGEN Cat# 12145 Calf intestine alkarine phosphatase Takara Cat# 2250A QIAEX II Gel Extraction Kit QIAGEN Cat# 20021 DNA Ligation Kit Ver.2.1 Takara Cat# 6022 Venoject II Terumo Cat# VP-DK051K Isoflurane Viatris – Domitor Nippon Zenyaku Kogyo – Midazolam Sandoz – Vetorphale Meiji Seika Pharma – Antisedan Nippon Zenyaku Kogyo – Deposited data Metabolomics data (Skeletal muscle, FoxO1 overexpression and immobilization, FoxO1-Tg and C57BL/6J) https://www. metabolomicsworkbench.org Metabolomics Workbench Study ID: ST003721; Project ID: PR002310 Metabolomics data (plasma, FoxO1 overexpression and immobilization, FoxO1-Tg and C57BL/6J) https://www. metabolomicsworkbench.org Metabolomics Workbench Study ID: ST003722; Project ID: PR002311 Metabolomics data (Skeletal muscle, Cancer cachexia and starvation, C57BL/6J) https://www. metabolomicsworkbench.org Metabolomics Workbench Study ID: ST003723; Project ID: PR002312 Metabolomics data (Skeletal muscle, immobilization, mFoxO1,3,4 flox/flox and mFoxO1,3,4 − /− ) https://www. metabolomicsworkbench.org Metabolomics Workbench Study ID: ST003724; Project ID: PR002313 Experimental models: Cell lines LLC cells: LL/2 (LLC1) ATCC CRL-1642 Primary myoblast This paper N/A C2C12 myoblasts Riken Cell Bank RCB0987 C2C12 myoblasts (Western blot analysis for SUnSET analysis and MG-132 experiment) ATCC CRL-1772 HEK293T cells Oyabu et al. 29 N/A Experimental models: Organisms/strains Mouse: C57BL/6J CLEA – Mouse: HSA-FOXO1-Tg Kamei Lab N/A Mouse: HSA-Cre FoxO1,3,4 flox/flox Kamei Lab N/A Mouse: HSA-DN-FOXO1-Tg Yamazaki et al. 42 N/A (Continued on next page) Cell Reports 44, 116097, August 26, 2025 19 .. REAGENT or RESOURCE SOURCE IDENTIFIER Oligonucleotides Primers for genotyping This paper Table S1 Primer for RT-qPCR This paper Table S2 MISSION siRNA Universal Negative Control #1 Sigma-Aldrich Cat# SIC001 MISSION siAmd2_1 Sigma-Aldrich Cat# SASI_Mm02_00311615 MISSION siAmd2_2 Sigma-Aldrich Cat# SASI_Mm01_00156378 Recombinant DNA pCAG-FOXO1(3A) Oyabu et al. 29 N/A pCMX-GFP Oyabu et al. 29 N/A pGL3-Odc1 promoter-luciferase This paper N/A phRL-TK Promega Cat# E2241 Software and algorithms Prism 10 software GraphPad Software – ImageJ NIH https://imagej.nih.gov/ij/download.html BZ-X800 Viewer Keyence – BZ-X800 Analyzer Keyence – ImageLab software Bio-Rad – Venn Diagrams Bioinformatics & Evolutionary Genomics http://bioinformatics.psb.ugent.be/ webtools/Venn/ Cluster 3.0 de Hoon et al. 43 http://bonsai.hgc.jp/∼mdehoon/ software/cluster/ Java TreeView Saldanha et al. 44 https://jtreeview.sourceforge.net MasterHands ver.2 software (Keio University, Tsuruoka, Yamagata, Japan) Sugimoto t al. 45 N/A MetaboAnalyst Pang et al. 46 https://www.metaboanalyst.ca/ LabSolutions LCMS Shimadzu N/A RNAseqChef Etoh and Nakao 47 https://imeg-ku.shinyapps.io/RNAseqChef/ GREIN: GEO RNA-seq Experiments Interactive Navigator Mahi et al. 48 https://www.ilincs.org/apps/grein/ SarcoAtlas Ham et al. 49 and Borsch et al. 50 https://sarcoatlas.scicore.unibas.ch Ensembl Harrison et al. 51 https://asia.ensembl.org Clustal Omega Multiple sequence Alighment (MSA) Madeira et al. 52 https://www.ebi.ac.uk/ jdispatcher/msa/clustalo R system R Core Team https://cran.r-project.org Programming environment of R: RStudio RStudio Team https://www.rstudio.com Adobe Illustrator Adobe https://www.adobe.com Excel Microsoft https://www.microsoft.com/ en-us/microsoft-365/excel BioRender: Scientific Image and Illustration Software N/A https://www.biorender.com Primer Express 2.0 Thermo Fisher – Primer-BLAST NIH https://www.ncbi.nlm.nih.gov/tools/primer- blast/https://www.ilincs.org/apps/grein/ Other Metabolomic analyses (CE-TOFMS) Human Metabolome Technologies N/A Agilent CE-TOFMS system Agilent Technologies – LCMS-8040 triple quadrupole mass spectrometer Shimadzu – Grip strength meter Melquest Cat# GPM-101B CFX Connect Real-Time PCR Detection System Bio-Rad Cat# 1855201J1 ChemiDoc XRS+ Imaging System Bio-Rad Cat# 1708265J1 (Continued on next page) 20 Cell Reports 44, 116097, August 26, 2025 ..

    Metabolomic:

    Article Title: Multi-dimensional metabolomic remodeling under diverse muscle atrophic stimuli in vivo.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER TSKgel Amide-80 (3.0 μm, 2.0 mm × 15 cm TOSOH Corporation Cat# 0021865 G266 DNA Damage Detection Kit - γH2AX - Red Dojindo Molecular Technologies Cat# 340-09431 HEPES Nacalai Tesque Cat# 02443-34 Trichloroacetic acid Nacalai Tesque Cat# 06275-24 L-Methionine sulfome Thermo Fisher Cat# A17027 Takara Taq Takara Cat# R001A Takara Ex Taq Takara Cat# RR001A Agarose for ≧1kbp fragment (Fine Powder) Nacalai Tesque Cat# 02468-95 100 bp DNA ladder One Nacalai Tesque Cat# 07908-75 6x Loading Dye Toyobo Cat# RE-DYE Ethidium Bromide Solution Nacalai Tesque Cat# 14631-94 Sodium Chloride Nacalai Tesque Cat# 31320-05 Bacto TM Peptone DIFCO Cat# 0118-17-0 Extract Yeast Dried Nacalai Tesque Cat# 15838-45 Bacto TM Agar BD Cat# 214010 Competent Quick DH5α Toyobo Cat# DNA-913 Ampicillin Sodium Salt Nacalai Tesque Cat# 02739-74 KOD-Plus-Neo Toyobo Cat# KOD-401 QIAGEN Plasmid Midi kit QIAGEN Cat# 12145 Calf intestine alkarine phosphatase Takara Cat# 2250A QIAEX II Gel Extraction Kit QIAGEN Cat# 20021 DNA Ligation Kit Ver.2.1 Takara Cat# 6022 Venoject II Terumo Cat# VP-DK051K Isoflurane Viatris – Domitor Nippon Zenyaku Kogyo – Midazolam Sandoz – Vetorphale Meiji Seika Pharma – Antisedan Nippon Zenyaku Kogyo – Deposited data Metabolomics data (Skeletal muscle, FoxO1 overexpression and immobilization, FoxO1-Tg and C57BL/6J) https://www. metabolomicsworkbench.org Metabolomics Workbench Study ID: ST003721; Project ID: PR002310 Metabolomics data (plasma, FoxO1 overexpression and immobilization, FoxO1-Tg and C57BL/6J) https://www. metabolomicsworkbench.org Metabolomics Workbench Study ID: ST003722; Project ID: PR002311 Metabolomics data (Skeletal muscle, Cancer cachexia and starvation, C57BL/6J) https://www. metabolomicsworkbench.org Metabolomics Workbench Study ID: ST003723; Project ID: PR002312 Metabolomics data (Skeletal muscle, immobilization, mFoxO1,3,4 flox/flox and mFoxO1,3,4 − /− ) https://www. metabolomicsworkbench.org Metabolomics Workbench Study ID: ST003724; Project ID: PR002313 Experimental models: Cell lines LLC cells: LL/2 (LLC1) ATCC CRL-1642 Primary myoblast This paper N/A C2C12 myoblasts Riken Cell Bank RCB0987 C2C12 myoblasts (Western blot analysis for SUnSET analysis and MG-132 experiment) ATCC CRL-1772 HEK293T cells Oyabu et al. 29 N/A Experimental models: Organisms/strains Mouse: C57BL/6J CLEA – Mouse: HSA-FOXO1-Tg Kamei Lab N/A Mouse: HSA-Cre FoxO1,3,4 flox/flox Kamei Lab N/A Mouse: HSA-DN-FOXO1-Tg Yamazaki et al. 42 N/A (Continued on next page) Cell Reports 44, 116097, August 26, 2025 19 .. REAGENT or RESOURCE SOURCE IDENTIFIER Oligonucleotides Primers for genotyping This paper Table S1 Primer for RT-qPCR This paper Table S2 MISSION siRNA Universal Negative Control #1 Sigma-Aldrich Cat# SIC001 MISSION siAmd2_1 Sigma-Aldrich Cat# SASI_Mm02_00311615 MISSION siAmd2_2 Sigma-Aldrich Cat# SASI_Mm01_00156378 Recombinant DNA pCAG-FOXO1(3A) Oyabu et al. 29 N/A pCMX-GFP Oyabu et al. 29 N/A pGL3-Odc1 promoter-luciferase This paper N/A phRL-TK Promega Cat# E2241 Software and algorithms Prism 10 software GraphPad Software – ImageJ NIH https://imagej.nih.gov/ij/download.html BZ-X800 Viewer Keyence – BZ-X800 Analyzer Keyence – ImageLab software Bio-Rad – Venn Diagrams Bioinformatics & Evolutionary Genomics http://bioinformatics.psb.ugent.be/ webtools/Venn/ Cluster 3.0 de Hoon et al. 43 http://bonsai.hgc.jp/∼mdehoon/ software/cluster/ Java TreeView Saldanha et al. 44 https://jtreeview.sourceforge.net MasterHands ver.2 software (Keio University, Tsuruoka, Yamagata, Japan) Sugimoto t al. 45 N/A MetaboAnalyst Pang et al. 46 https://www.metaboanalyst.ca/ LabSolutions LCMS Shimadzu N/A RNAseqChef Etoh and Nakao 47 https://imeg-ku.shinyapps.io/RNAseqChef/ GREIN: GEO RNA-seq Experiments Interactive Navigator Mahi et al. 48 https://www.ilincs.org/apps/grein/ SarcoAtlas Ham et al. 49 and Borsch et al. 50 https://sarcoatlas.scicore.unibas.ch Ensembl Harrison et al. 51 https://asia.ensembl.org Clustal Omega Multiple sequence Alighment (MSA) Madeira et al. 52 https://www.ebi.ac.uk/ jdispatcher/msa/clustalo R system R Core Team https://cran.r-project.org Programming environment of R: RStudio RStudio Team https://www.rstudio.com Adobe Illustrator Adobe https://www.adobe.com Excel Microsoft https://www.microsoft.com/ en-us/microsoft-365/excel BioRender: Scientific Image and Illustration Software N/A https://www.biorender.com Primer Express 2.0 Thermo Fisher – Primer-BLAST NIH https://www.ncbi.nlm.nih.gov/tools/primer- blast/https://www.ilincs.org/apps/grein/ Other Metabolomic analyses (CE-TOFMS) Human Metabolome Technologies N/A Agilent CE-TOFMS system Agilent Technologies – LCMS-8040 triple quadrupole mass spectrometer Shimadzu – Grip strength meter Melquest Cat# GPM-101B CFX Connect Real-Time PCR Detection System Bio-Rad Cat# 1855201J1 ChemiDoc XRS+ Imaging System Bio-Rad Cat# 1708265J1 (Continued on next page) 20 Cell Reports 44, 116097, August 26, 2025 ..

    Targeted Proteomics:

    Article Title: Multi-dimensional metabolomic remodeling under diverse muscle atrophic stimuli in vivo.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER TSKgel Amide-80 (3.0 μm, 2.0 mm × 15 cm TOSOH Corporation Cat# 0021865 G266 DNA Damage Detection Kit - γH2AX - Red Dojindo Molecular Technologies Cat# 340-09431 HEPES Nacalai Tesque Cat# 02443-34 Trichloroacetic acid Nacalai Tesque Cat# 06275-24 L-Methionine sulfome Thermo Fisher Cat# A17027 Takara Taq Takara Cat# R001A Takara Ex Taq Takara Cat# RR001A Agarose for ≧1kbp fragment (Fine Powder) Nacalai Tesque Cat# 02468-95 100 bp DNA ladder One Nacalai Tesque Cat# 07908-75 6x Loading Dye Toyobo Cat# RE-DYE Ethidium Bromide Solution Nacalai Tesque Cat# 14631-94 Sodium Chloride Nacalai Tesque Cat# 31320-05 Bacto TM Peptone DIFCO Cat# 0118-17-0 Extract Yeast Dried Nacalai Tesque Cat# 15838-45 Bacto TM Agar BD Cat# 214010 Competent Quick DH5α Toyobo Cat# DNA-913 Ampicillin Sodium Salt Nacalai Tesque Cat# 02739-74 KOD-Plus-Neo Toyobo Cat# KOD-401 QIAGEN Plasmid Midi kit QIAGEN Cat# 12145 Calf intestine alkarine phosphatase Takara Cat# 2250A QIAEX II Gel Extraction Kit QIAGEN Cat# 20021 DNA Ligation Kit Ver.2.1 Takara Cat# 6022 Venoject II Terumo Cat# VP-DK051K Isoflurane Viatris – Domitor Nippon Zenyaku Kogyo – Midazolam Sandoz – Vetorphale Meiji Seika Pharma – Antisedan Nippon Zenyaku Kogyo – Deposited data Metabolomics data (Skeletal muscle, FoxO1 overexpression and immobilization, FoxO1-Tg and C57BL/6J) https://www. metabolomicsworkbench.org Metabolomics Workbench Study ID: ST003721; Project ID: PR002310 Metabolomics data (plasma, FoxO1 overexpression and immobilization, FoxO1-Tg and C57BL/6J) https://www. metabolomicsworkbench.org Metabolomics Workbench Study ID: ST003722; Project ID: PR002311 Metabolomics data (Skeletal muscle, Cancer cachexia and starvation, C57BL/6J) https://www. metabolomicsworkbench.org Metabolomics Workbench Study ID: ST003723; Project ID: PR002312 Metabolomics data (Skeletal muscle, immobilization, mFoxO1,3,4 flox/flox and mFoxO1,3,4 − /− ) https://www. metabolomicsworkbench.org Metabolomics Workbench Study ID: ST003724; Project ID: PR002313 Experimental models: Cell lines LLC cells: LL/2 (LLC1) ATCC CRL-1642 Primary myoblast This paper N/A C2C12 myoblasts Riken Cell Bank RCB0987 C2C12 myoblasts (Western blot analysis for SUnSET analysis and MG-132 experiment) ATCC CRL-1772 HEK293T cells Oyabu et al. 29 N/A Experimental models: Organisms/strains Mouse: C57BL/6J CLEA – Mouse: HSA-FOXO1-Tg Kamei Lab N/A Mouse: HSA-Cre FoxO1,3,4 flox/flox Kamei Lab N/A Mouse: HSA-DN-FOXO1-Tg Yamazaki et al. 42 N/A (Continued on next page) Cell Reports 44, 116097, August 26, 2025 19 .. REAGENT or RESOURCE SOURCE IDENTIFIER Oligonucleotides Primers for genotyping This paper Table S1 Primer for RT-qPCR This paper Table S2 MISSION siRNA Universal Negative Control #1 Sigma-Aldrich Cat# SIC001 MISSION siAmd2_1 Sigma-Aldrich Cat# SASI_Mm02_00311615 MISSION siAmd2_2 Sigma-Aldrich Cat# SASI_Mm01_00156378 Recombinant DNA pCAG-FOXO1(3A) Oyabu et al. 29 N/A pCMX-GFP Oyabu et al. 29 N/A pGL3-Odc1 promoter-luciferase This paper N/A phRL-TK Promega Cat# E2241 Software and algorithms Prism 10 software GraphPad Software – ImageJ NIH https://imagej.nih.gov/ij/download.html BZ-X800 Viewer Keyence – BZ-X800 Analyzer Keyence – ImageLab software Bio-Rad – Venn Diagrams Bioinformatics & Evolutionary Genomics http://bioinformatics.psb.ugent.be/ webtools/Venn/ Cluster 3.0 de Hoon et al. 43 http://bonsai.hgc.jp/∼mdehoon/ software/cluster/ Java TreeView Saldanha et al. 44 https://jtreeview.sourceforge.net MasterHands ver.2 software (Keio University, Tsuruoka, Yamagata, Japan) Sugimoto t al. 45 N/A MetaboAnalyst Pang et al. 46 https://www.metaboanalyst.ca/ LabSolutions LCMS Shimadzu N/A RNAseqChef Etoh and Nakao 47 https://imeg-ku.shinyapps.io/RNAseqChef/ GREIN: GEO RNA-seq Experiments Interactive Navigator Mahi et al. 48 https://www.ilincs.org/apps/grein/ SarcoAtlas Ham et al. 49 and Borsch et al. 50 https://sarcoatlas.scicore.unibas.ch Ensembl Harrison et al. 51 https://asia.ensembl.org Clustal Omega Multiple sequence Alighment (MSA) Madeira et al. 52 https://www.ebi.ac.uk/ jdispatcher/msa/clustalo R system R Core Team https://cran.r-project.org Programming environment of R: RStudio RStudio Team https://www.rstudio.com Adobe Illustrator Adobe https://www.adobe.com Excel Microsoft https://www.microsoft.com/ en-us/microsoft-365/excel BioRender: Scientific Image and Illustration Software N/A https://www.biorender.com Primer Express 2.0 Thermo Fisher – Primer-BLAST NIH https://www.ncbi.nlm.nih.gov/tools/primer- blast/https://www.ilincs.org/apps/grein/ Other Metabolomic analyses (CE-TOFMS) Human Metabolome Technologies N/A Agilent CE-TOFMS system Agilent Technologies – LCMS-8040 triple quadrupole mass spectrometer Shimadzu – Grip strength meter Melquest Cat# GPM-101B CFX Connect Real-Time PCR Detection System Bio-Rad Cat# 1855201J1 ChemiDoc XRS+ Imaging System Bio-Rad Cat# 1708265J1 (Continued on next page) 20 Cell Reports 44, 116097, August 26, 2025 ..

    Mass Spectrometry:

    Article Title: Multi-dimensional metabolomic remodeling under diverse muscle atrophic stimuli in vivo.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER TSKgel Amide-80 (3.0 μm, 2.0 mm × 15 cm TOSOH Corporation Cat# 0021865 G266 DNA Damage Detection Kit - γH2AX - Red Dojindo Molecular Technologies Cat# 340-09431 HEPES Nacalai Tesque Cat# 02443-34 Trichloroacetic acid Nacalai Tesque Cat# 06275-24 L-Methionine sulfome Thermo Fisher Cat# A17027 Takara Taq Takara Cat# R001A Takara Ex Taq Takara Cat# RR001A Agarose for ≧1kbp fragment (Fine Powder) Nacalai Tesque Cat# 02468-95 100 bp DNA ladder One Nacalai Tesque Cat# 07908-75 6x Loading Dye Toyobo Cat# RE-DYE Ethidium Bromide Solution Nacalai Tesque Cat# 14631-94 Sodium Chloride Nacalai Tesque Cat# 31320-05 Bacto TM Peptone DIFCO Cat# 0118-17-0 Extract Yeast Dried Nacalai Tesque Cat# 15838-45 Bacto TM Agar BD Cat# 214010 Competent Quick DH5α Toyobo Cat# DNA-913 Ampicillin Sodium Salt Nacalai Tesque Cat# 02739-74 KOD-Plus-Neo Toyobo Cat# KOD-401 QIAGEN Plasmid Midi kit QIAGEN Cat# 12145 Calf intestine alkarine phosphatase Takara Cat# 2250A QIAEX II Gel Extraction Kit QIAGEN Cat# 20021 DNA Ligation Kit Ver.2.1 Takara Cat# 6022 Venoject II Terumo Cat# VP-DK051K Isoflurane Viatris – Domitor Nippon Zenyaku Kogyo – Midazolam Sandoz – Vetorphale Meiji Seika Pharma – Antisedan Nippon Zenyaku Kogyo – Deposited data Metabolomics data (Skeletal muscle, FoxO1 overexpression and immobilization, FoxO1-Tg and C57BL/6J) https://www. metabolomicsworkbench.org Metabolomics Workbench Study ID: ST003721; Project ID: PR002310 Metabolomics data (plasma, FoxO1 overexpression and immobilization, FoxO1-Tg and C57BL/6J) https://www. metabolomicsworkbench.org Metabolomics Workbench Study ID: ST003722; Project ID: PR002311 Metabolomics data (Skeletal muscle, Cancer cachexia and starvation, C57BL/6J) https://www. metabolomicsworkbench.org Metabolomics Workbench Study ID: ST003723; Project ID: PR002312 Metabolomics data (Skeletal muscle, immobilization, mFoxO1,3,4 flox/flox and mFoxO1,3,4 − /− ) https://www. metabolomicsworkbench.org Metabolomics Workbench Study ID: ST003724; Project ID: PR002313 Experimental models: Cell lines LLC cells: LL/2 (LLC1) ATCC CRL-1642 Primary myoblast This paper N/A C2C12 myoblasts Riken Cell Bank RCB0987 C2C12 myoblasts (Western blot analysis for SUnSET analysis and MG-132 experiment) ATCC CRL-1772 HEK293T cells Oyabu et al. 29 N/A Experimental models: Organisms/strains Mouse: C57BL/6J CLEA – Mouse: HSA-FOXO1-Tg Kamei Lab N/A Mouse: HSA-Cre FoxO1,3,4 flox/flox Kamei Lab N/A Mouse: HSA-DN-FOXO1-Tg Yamazaki et al. 42 N/A (Continued on next page) Cell Reports 44, 116097, August 26, 2025 19 .. REAGENT or RESOURCE SOURCE IDENTIFIER Oligonucleotides Primers for genotyping This paper Table S1 Primer for RT-qPCR This paper Table S2 MISSION siRNA Universal Negative Control #1 Sigma-Aldrich Cat# SIC001 MISSION siAmd2_1 Sigma-Aldrich Cat# SASI_Mm02_00311615 MISSION siAmd2_2 Sigma-Aldrich Cat# SASI_Mm01_00156378 Recombinant DNA pCAG-FOXO1(3A) Oyabu et al. 29 N/A pCMX-GFP Oyabu et al. 29 N/A pGL3-Odc1 promoter-luciferase This paper N/A phRL-TK Promega Cat# E2241 Software and algorithms Prism 10 software GraphPad Software – ImageJ NIH https://imagej.nih.gov/ij/download.html BZ-X800 Viewer Keyence – BZ-X800 Analyzer Keyence – ImageLab software Bio-Rad – Venn Diagrams Bioinformatics & Evolutionary Genomics http://bioinformatics.psb.ugent.be/ webtools/Venn/ Cluster 3.0 de Hoon et al. 43 http://bonsai.hgc.jp/∼mdehoon/ software/cluster/ Java TreeView Saldanha et al. 44 https://jtreeview.sourceforge.net MasterHands ver.2 software (Keio University, Tsuruoka, Yamagata, Japan) Sugimoto t al. 45 N/A MetaboAnalyst Pang et al. 46 https://www.metaboanalyst.ca/ LabSolutions LCMS Shimadzu N/A RNAseqChef Etoh and Nakao 47 https://imeg-ku.shinyapps.io/RNAseqChef/ GREIN: GEO RNA-seq Experiments Interactive Navigator Mahi et al. 48 https://www.ilincs.org/apps/grein/ SarcoAtlas Ham et al. 49 and Borsch et al. 50 https://sarcoatlas.scicore.unibas.ch Ensembl Harrison et al. 51 https://asia.ensembl.org Clustal Omega Multiple sequence Alighment (MSA) Madeira et al. 52 https://www.ebi.ac.uk/ jdispatcher/msa/clustalo R system R Core Team https://cran.r-project.org Programming environment of R: RStudio RStudio Team https://www.rstudio.com Adobe Illustrator Adobe https://www.adobe.com Excel Microsoft https://www.microsoft.com/ en-us/microsoft-365/excel BioRender: Scientific Image and Illustration Software N/A https://www.biorender.com Primer Express 2.0 Thermo Fisher – Primer-BLAST NIH https://www.ncbi.nlm.nih.gov/tools/primer- blast/https://www.ilincs.org/apps/grein/ Other Metabolomic analyses (CE-TOFMS) Human Metabolome Technologies N/A Agilent CE-TOFMS system Agilent Technologies – LCMS-8040 triple quadrupole mass spectrometer Shimadzu – Grip strength meter Melquest Cat# GPM-101B CFX Connect Real-Time PCR Detection System Bio-Rad Cat# 1855201J1 ChemiDoc XRS+ Imaging System Bio-Rad Cat# 1708265J1 (Continued on next page) 20 Cell Reports 44, 116097, August 26, 2025 ..

    Magnetic Beads:

    Article Title: The phosphodiesterase 2A controls lymphatic junctional maturation via cGMP-dependent notch signaling.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Experimental models: Cell lines HDLECs PromoCell Cat# C-12216 HUVECs PromoCell Cat# C-12203 mECs This manuscript N/A Experimental models: Organisms/strains Mouse: Tie2-Cre (B6.Cg-Tg(Tek-cre) 1Ywa/J) Kisanuki et al.69 RRID:IMSR_JAX:008863 Mouse: Cdh5-CreERT2 (Tg(Cdh5-cre/ ERT2)1Rha) Sörensen et al.70 RRID:IMSR_EM:14891 Mouse: Prox1-CreERT2 (Tg(Prox1-cre/ ERT2)1Tmak Bazigou et al.71 RRID:IMSR_EM:13737 Mouse: Pde2a global knockout (B6; 129P2487Pde2A < tm1Dgen>/H; EM: 02366) Assenza et al.25 RRID:IMSR_EM:02366 Mouse: Pde2a (Pde2atm1a(EUCOMM)Wtsl) This manuscript N/A Oligonucleotides AllStars Negative CTRL siRNA Qiagen Cat# 1027281 FlexiTube PDE2A siRNA Qiagen Cat# SI00040159 DLL1 (hs00194509_m1) Thermo Fischer Scientific Cat# 4331182 GAPDH (hs99999905) Thermo Fischer Scientific Cat# 4326317E Gapdh (mm99999915_g1) Thermo Fischer Scientific Cat# 4352932E GJA4 (hs00704917_s1) Thermo Fischer Scientific Cat# 4331182 Hey1 (mm00468865_m1) Thermo Fischer Scientific Cat# 4331182 miR-139-5p (MI0000693) Thermo Fischer Scientific Cat# 002289 Mki67 (mm01278617_m1) Thermo Fischer Scientific Cat# 4331182 PDE10A (hs01098928_m1) Thermo Fischer Scientific Cat# 4351372 PDE12 (hs00698272_m1) Thermo Fischer Scientific Cat# 4331182 PDE2A (hs00159935_m1) Thermo Fischer Scientific Cat# 4331182 Pde2a (mm01136644_m1) Thermo Fischer Scientific Cat# 4331182 PDE3A (hs01012698_m1) Thermo Fischer Scientific Cat# 4331182 PDE4B (hs00963643_m1) Thermo Fischer Scientific Cat# 4331182 PDE4D (hs01579625_m1) Thermo Fischer Scientific Cat# 4331182 PDE6D (hs01062025_m1) Thermo Fischer Scientific Cat# 4331182 PDE8A (hs01079617_m1) Thermo Fischer Scientific Cat# 4331182 PSEN2 (hs01577197_m1) Thermo Fischer Scientific Cat# 4331182 RNU48 (TaqMan MicroRNA Assay) Thermo Fischer Scientific Cat# 001006 snoRNA202 (TaqMan MicroRNA Assay) Thermo Fischer Scientific Cat# 001232 snoRNA234 (TaqMan MicroRNA Assay) Thermo Fischer Scientific Cat# 001234 Pde2a-5’-arm 50ACTGGTCAGTTCTGAGC CTCACCC 30 This paper N/A Pde2a-3’-arm 50 AGTCTGGACTCCCCA TCTAGCAGG 30 This paper N/A Cre transgene sense 50GAACCTGATGG ACATGTTCAGG 30 This paper N/A Cre transgene antisense 50 AGTGCGTT CGAACGCTAGAGCCTGT 30 This paper N/A Myogenin sense 50 TTACGTCCA TCGTGGACAGC 30 This paper N/A Myogenin antisense 50 TGGGCTGGGT GTTAGCCTTA 30 This paper N/A (Continued on next page) e4 Developmental Cell 59, 1–18.e1–e11, February 5, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER Software and algorithms BioRad Image Lab Software BioRad N/A Diva 8.0.1 software BD Biosciences N/A Fiji ImageJ N/A https://imagej.net/ij/ GraphPad Prism 9 Dotmatics N/A Leica LAS-X software Leica N/A MicroManager 1.4 software Open source N/A Seurat package Satija et al.72 https://www.nature.com/articles/nbt.3192 umap package McInnes et al.73 https://joss.theoj.org/papers/10.21105/ joss.00861 Plotly software Open source https://plotly.com/r/ FastQC (v0.11.9) Open source http://www.bioinformatics.babraham.ac. uk/projects/fastqc/ Trimmomatic (v0.36) Bolger et al.74 https://academic.oup.com/bioinformatics/ article/30/15/2114/2390096?login=true STAR (v2.7.3a) Dobin et al.75 https://academic.oup.com/bioinformatics/ article/29/1/15/272537 ComBat-seq Zhang et al.76 https://academic.oup.com/nargab/article/ 2/3/lqaa078/5909519?searchresult=1 WebGestalt platform 2019 Liao et al.77 https://academic.oup.com/nar/article/47/ W1/W199/5494758?login=true Other 24-well Plate Softwell Easy Coat hydrogels (0.1, 1, 2, 4 and 25kPa) Matrigen Cat# SS24-EC 8-well Lab-Tek II chamber slides Lab-Tek Cat# 154941 Agilent Technologies 2100 bioanalyzer Agilent https://www.agilent.com/en/product/ automated-electrophoresis/bioanalyzersystems/bioanalyzer-instrument AMPure XP magnetic beads Beckman Cat# A53880 Axiocam 208 Color Zeiss N/A BD Biosciences FACSAria IIIu BD Biosciences N/A CoolLED beam-splitter DV2 Dual View Photometrics N/A CMOS camera chip OptiMOS, Qimaging N/A DEAE-Sephadex A-25 columns Cytiva Cat# 17017001 DynaMag -2 Invitrogen Cat# 12321D Gel Doc MP Imaging System BioRad N/A Hamilton TLC syringe Sigma-Aldrich Cat# HAM7635-01-1EA Immobilion -P Transfer Membrane (0.45mm pore size) Merck Cat# IPVH00010 Inject -F syringe Braun Cat# 9166017V Leica DMI 3000 B inverted fluorescent microscope Leica N/A Leica SP8 inverted microscope Leica N/A Nikon Eclipse Ts2R microscope Nikon N/A Sheep-anti-rat IgG Dynabeads Invitrogen Cat# 110-35 StepOnePlus RT PCR system Applied Biosystems N/A Tecan Spark 10M microplate reader Tecan N/A Tissue culture-treated dishes Corning Cat# 430167 Tissue culture-treated dishes (60mm) Corning Cat# 430166 Transwell filters (0.4mm pore size) Corning Cat# 3413 (Continued on next page) Developmental Cell 59, 1–18.e1–e11, February 5, 2024 e5 .. REAGENT or RESOURCE SOURCE IDENTIFIER Tri-Carb 2100TR Liquid Scintillation Counter Packard Instruments Cat# 2000CA ULTIMA GOLD scintillation liquid PerkinElmer Cat# 6013326 UltraComp eBeads Plus Compensation Beads Invitrogen Cat# 01-3333-42 Zeiss Stemi 508 Zeiss N/A

    Thin Layer Chromatography:

    Article Title: The phosphodiesterase 2A controls lymphatic junctional maturation via cGMP-dependent notch signaling.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Experimental models: Cell lines HDLECs PromoCell Cat# C-12216 HUVECs PromoCell Cat# C-12203 mECs This manuscript N/A Experimental models: Organisms/strains Mouse: Tie2-Cre (B6.Cg-Tg(Tek-cre) 1Ywa/J) Kisanuki et al.69 RRID:IMSR_JAX:008863 Mouse: Cdh5-CreERT2 (Tg(Cdh5-cre/ ERT2)1Rha) Sörensen et al.70 RRID:IMSR_EM:14891 Mouse: Prox1-CreERT2 (Tg(Prox1-cre/ ERT2)1Tmak Bazigou et al.71 RRID:IMSR_EM:13737 Mouse: Pde2a global knockout (B6; 129P2487Pde2A < tm1Dgen>/H; EM: 02366) Assenza et al.25 RRID:IMSR_EM:02366 Mouse: Pde2a (Pde2atm1a(EUCOMM)Wtsl) This manuscript N/A Oligonucleotides AllStars Negative CTRL siRNA Qiagen Cat# 1027281 FlexiTube PDE2A siRNA Qiagen Cat# SI00040159 DLL1 (hs00194509_m1) Thermo Fischer Scientific Cat# 4331182 GAPDH (hs99999905) Thermo Fischer Scientific Cat# 4326317E Gapdh (mm99999915_g1) Thermo Fischer Scientific Cat# 4352932E GJA4 (hs00704917_s1) Thermo Fischer Scientific Cat# 4331182 Hey1 (mm00468865_m1) Thermo Fischer Scientific Cat# 4331182 miR-139-5p (MI0000693) Thermo Fischer Scientific Cat# 002289 Mki67 (mm01278617_m1) Thermo Fischer Scientific Cat# 4331182 PDE10A (hs01098928_m1) Thermo Fischer Scientific Cat# 4351372 PDE12 (hs00698272_m1) Thermo Fischer Scientific Cat# 4331182 PDE2A (hs00159935_m1) Thermo Fischer Scientific Cat# 4331182 Pde2a (mm01136644_m1) Thermo Fischer Scientific Cat# 4331182 PDE3A (hs01012698_m1) Thermo Fischer Scientific Cat# 4331182 PDE4B (hs00963643_m1) Thermo Fischer Scientific Cat# 4331182 PDE4D (hs01579625_m1) Thermo Fischer Scientific Cat# 4331182 PDE6D (hs01062025_m1) Thermo Fischer Scientific Cat# 4331182 PDE8A (hs01079617_m1) Thermo Fischer Scientific Cat# 4331182 PSEN2 (hs01577197_m1) Thermo Fischer Scientific Cat# 4331182 RNU48 (TaqMan MicroRNA Assay) Thermo Fischer Scientific Cat# 001006 snoRNA202 (TaqMan MicroRNA Assay) Thermo Fischer Scientific Cat# 001232 snoRNA234 (TaqMan MicroRNA Assay) Thermo Fischer Scientific Cat# 001234 Pde2a-5’-arm 50ACTGGTCAGTTCTGAGC CTCACCC 30 This paper N/A Pde2a-3’-arm 50 AGTCTGGACTCCCCA TCTAGCAGG 30 This paper N/A Cre transgene sense 50GAACCTGATGG ACATGTTCAGG 30 This paper N/A Cre transgene antisense 50 AGTGCGTT CGAACGCTAGAGCCTGT 30 This paper N/A Myogenin sense 50 TTACGTCCA TCGTGGACAGC 30 This paper N/A Myogenin antisense 50 TGGGCTGGGT GTTAGCCTTA 30 This paper N/A (Continued on next page) e4 Developmental Cell 59, 1–18.e1–e11, February 5, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER Software and algorithms BioRad Image Lab Software BioRad N/A Diva 8.0.1 software BD Biosciences N/A Fiji ImageJ N/A https://imagej.net/ij/ GraphPad Prism 9 Dotmatics N/A Leica LAS-X software Leica N/A MicroManager 1.4 software Open source N/A Seurat package Satija et al.72 https://www.nature.com/articles/nbt.3192 umap package McInnes et al.73 https://joss.theoj.org/papers/10.21105/ joss.00861 Plotly software Open source https://plotly.com/r/ FastQC (v0.11.9) Open source http://www.bioinformatics.babraham.ac. uk/projects/fastqc/ Trimmomatic (v0.36) Bolger et al.74 https://academic.oup.com/bioinformatics/ article/30/15/2114/2390096?login=true STAR (v2.7.3a) Dobin et al.75 https://academic.oup.com/bioinformatics/ article/29/1/15/272537 ComBat-seq Zhang et al.76 https://academic.oup.com/nargab/article/ 2/3/lqaa078/5909519?searchresult=1 WebGestalt platform 2019 Liao et al.77 https://academic.oup.com/nar/article/47/ W1/W199/5494758?login=true Other 24-well Plate Softwell Easy Coat hydrogels (0.1, 1, 2, 4 and 25kPa) Matrigen Cat# SS24-EC 8-well Lab-Tek II chamber slides Lab-Tek Cat# 154941 Agilent Technologies 2100 bioanalyzer Agilent https://www.agilent.com/en/product/ automated-electrophoresis/bioanalyzersystems/bioanalyzer-instrument AMPure XP magnetic beads Beckman Cat# A53880 Axiocam 208 Color Zeiss N/A BD Biosciences FACSAria IIIu BD Biosciences N/A CoolLED beam-splitter DV2 Dual View Photometrics N/A CMOS camera chip OptiMOS, Qimaging N/A DEAE-Sephadex A-25 columns Cytiva Cat# 17017001 DynaMag -2 Invitrogen Cat# 12321D Gel Doc MP Imaging System BioRad N/A Hamilton TLC syringe Sigma-Aldrich Cat# HAM7635-01-1EA Immobilion -P Transfer Membrane (0.45mm pore size) Merck Cat# IPVH00010 Inject -F syringe Braun Cat# 9166017V Leica DMI 3000 B inverted fluorescent microscope Leica N/A Leica SP8 inverted microscope Leica N/A Nikon Eclipse Ts2R microscope Nikon N/A Sheep-anti-rat IgG Dynabeads Invitrogen Cat# 110-35 StepOnePlus RT PCR system Applied Biosystems N/A Tecan Spark 10M microplate reader Tecan N/A Tissue culture-treated dishes Corning Cat# 430167 Tissue culture-treated dishes (60mm) Corning Cat# 430166 Transwell filters (0.4mm pore size) Corning Cat# 3413 (Continued on next page) Developmental Cell 59, 1–18.e1–e11, February 5, 2024 e5 .. REAGENT or RESOURCE SOURCE IDENTIFIER Tri-Carb 2100TR Liquid Scintillation Counter Packard Instruments Cat# 2000CA ULTIMA GOLD scintillation liquid PerkinElmer Cat# 6013326 UltraComp eBeads Plus Compensation Beads Invitrogen Cat# 01-3333-42 Zeiss Stemi 508 Zeiss N/A

    Membrane:

    Article Title: The phosphodiesterase 2A controls lymphatic junctional maturation via cGMP-dependent notch signaling.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Experimental models: Cell lines HDLECs PromoCell Cat# C-12216 HUVECs PromoCell Cat# C-12203 mECs This manuscript N/A Experimental models: Organisms/strains Mouse: Tie2-Cre (B6.Cg-Tg(Tek-cre) 1Ywa/J) Kisanuki et al.69 RRID:IMSR_JAX:008863 Mouse: Cdh5-CreERT2 (Tg(Cdh5-cre/ ERT2)1Rha) Sörensen et al.70 RRID:IMSR_EM:14891 Mouse: Prox1-CreERT2 (Tg(Prox1-cre/ ERT2)1Tmak Bazigou et al.71 RRID:IMSR_EM:13737 Mouse: Pde2a global knockout (B6; 129P2487Pde2A < tm1Dgen>/H; EM: 02366) Assenza et al.25 RRID:IMSR_EM:02366 Mouse: Pde2a (Pde2atm1a(EUCOMM)Wtsl) This manuscript N/A Oligonucleotides AllStars Negative CTRL siRNA Qiagen Cat# 1027281 FlexiTube PDE2A siRNA Qiagen Cat# SI00040159 DLL1 (hs00194509_m1) Thermo Fischer Scientific Cat# 4331182 GAPDH (hs99999905) Thermo Fischer Scientific Cat# 4326317E Gapdh (mm99999915_g1) Thermo Fischer Scientific Cat# 4352932E GJA4 (hs00704917_s1) Thermo Fischer Scientific Cat# 4331182 Hey1 (mm00468865_m1) Thermo Fischer Scientific Cat# 4331182 miR-139-5p (MI0000693) Thermo Fischer Scientific Cat# 002289 Mki67 (mm01278617_m1) Thermo Fischer Scientific Cat# 4331182 PDE10A (hs01098928_m1) Thermo Fischer Scientific Cat# 4351372 PDE12 (hs00698272_m1) Thermo Fischer Scientific Cat# 4331182 PDE2A (hs00159935_m1) Thermo Fischer Scientific Cat# 4331182 Pde2a (mm01136644_m1) Thermo Fischer Scientific Cat# 4331182 PDE3A (hs01012698_m1) Thermo Fischer Scientific Cat# 4331182 PDE4B (hs00963643_m1) Thermo Fischer Scientific Cat# 4331182 PDE4D (hs01579625_m1) Thermo Fischer Scientific Cat# 4331182 PDE6D (hs01062025_m1) Thermo Fischer Scientific Cat# 4331182 PDE8A (hs01079617_m1) Thermo Fischer Scientific Cat# 4331182 PSEN2 (hs01577197_m1) Thermo Fischer Scientific Cat# 4331182 RNU48 (TaqMan MicroRNA Assay) Thermo Fischer Scientific Cat# 001006 snoRNA202 (TaqMan MicroRNA Assay) Thermo Fischer Scientific Cat# 001232 snoRNA234 (TaqMan MicroRNA Assay) Thermo Fischer Scientific Cat# 001234 Pde2a-5’-arm 50ACTGGTCAGTTCTGAGC CTCACCC 30 This paper N/A Pde2a-3’-arm 50 AGTCTGGACTCCCCA TCTAGCAGG 30 This paper N/A Cre transgene sense 50GAACCTGATGG ACATGTTCAGG 30 This paper N/A Cre transgene antisense 50 AGTGCGTT CGAACGCTAGAGCCTGT 30 This paper N/A Myogenin sense 50 TTACGTCCA TCGTGGACAGC 30 This paper N/A Myogenin antisense 50 TGGGCTGGGT GTTAGCCTTA 30 This paper N/A (Continued on next page) e4 Developmental Cell 59, 1–18.e1–e11, February 5, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER Software and algorithms BioRad Image Lab Software BioRad N/A Diva 8.0.1 software BD Biosciences N/A Fiji ImageJ N/A https://imagej.net/ij/ GraphPad Prism 9 Dotmatics N/A Leica LAS-X software Leica N/A MicroManager 1.4 software Open source N/A Seurat package Satija et al.72 https://www.nature.com/articles/nbt.3192 umap package McInnes et al.73 https://joss.theoj.org/papers/10.21105/ joss.00861 Plotly software Open source https://plotly.com/r/ FastQC (v0.11.9) Open source http://www.bioinformatics.babraham.ac. uk/projects/fastqc/ Trimmomatic (v0.36) Bolger et al.74 https://academic.oup.com/bioinformatics/ article/30/15/2114/2390096?login=true STAR (v2.7.3a) Dobin et al.75 https://academic.oup.com/bioinformatics/ article/29/1/15/272537 ComBat-seq Zhang et al.76 https://academic.oup.com/nargab/article/ 2/3/lqaa078/5909519?searchresult=1 WebGestalt platform 2019 Liao et al.77 https://academic.oup.com/nar/article/47/ W1/W199/5494758?login=true Other 24-well Plate Softwell Easy Coat hydrogels (0.1, 1, 2, 4 and 25kPa) Matrigen Cat# SS24-EC 8-well Lab-Tek II chamber slides Lab-Tek Cat# 154941 Agilent Technologies 2100 bioanalyzer Agilent https://www.agilent.com/en/product/ automated-electrophoresis/bioanalyzersystems/bioanalyzer-instrument AMPure XP magnetic beads Beckman Cat# A53880 Axiocam 208 Color Zeiss N/A BD Biosciences FACSAria IIIu BD Biosciences N/A CoolLED beam-splitter DV2 Dual View Photometrics N/A CMOS camera chip OptiMOS, Qimaging N/A DEAE-Sephadex A-25 columns Cytiva Cat# 17017001 DynaMag -2 Invitrogen Cat# 12321D Gel Doc MP Imaging System BioRad N/A Hamilton TLC syringe Sigma-Aldrich Cat# HAM7635-01-1EA Immobilion -P Transfer Membrane (0.45mm pore size) Merck Cat# IPVH00010 Inject -F syringe Braun Cat# 9166017V Leica DMI 3000 B inverted fluorescent microscope Leica N/A Leica SP8 inverted microscope Leica N/A Nikon Eclipse Ts2R microscope Nikon N/A Sheep-anti-rat IgG Dynabeads Invitrogen Cat# 110-35 StepOnePlus RT PCR system Applied Biosystems N/A Tecan Spark 10M microplate reader Tecan N/A Tissue culture-treated dishes Corning Cat# 430167 Tissue culture-treated dishes (60mm) Corning Cat# 430166 Transwell filters (0.4mm pore size) Corning Cat# 3413 (Continued on next page) Developmental Cell 59, 1–18.e1–e11, February 5, 2024 e5 .. REAGENT or RESOURCE SOURCE IDENTIFIER Tri-Carb 2100TR Liquid Scintillation Counter Packard Instruments Cat# 2000CA ULTIMA GOLD scintillation liquid PerkinElmer Cat# 6013326 UltraComp eBeads Plus Compensation Beads Invitrogen Cat# 01-3333-42 Zeiss Stemi 508 Zeiss N/A

    Pore Size:

    Article Title: The phosphodiesterase 2A controls lymphatic junctional maturation via cGMP-dependent notch signaling.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Experimental models: Cell lines HDLECs PromoCell Cat# C-12216 HUVECs PromoCell Cat# C-12203 mECs This manuscript N/A Experimental models: Organisms/strains Mouse: Tie2-Cre (B6.Cg-Tg(Tek-cre) 1Ywa/J) Kisanuki et al.69 RRID:IMSR_JAX:008863 Mouse: Cdh5-CreERT2 (Tg(Cdh5-cre/ ERT2)1Rha) Sörensen et al.70 RRID:IMSR_EM:14891 Mouse: Prox1-CreERT2 (Tg(Prox1-cre/ ERT2)1Tmak Bazigou et al.71 RRID:IMSR_EM:13737 Mouse: Pde2a global knockout (B6; 129P2487Pde2A < tm1Dgen>/H; EM: 02366) Assenza et al.25 RRID:IMSR_EM:02366 Mouse: Pde2a (Pde2atm1a(EUCOMM)Wtsl) This manuscript N/A Oligonucleotides AllStars Negative CTRL siRNA Qiagen Cat# 1027281 FlexiTube PDE2A siRNA Qiagen Cat# SI00040159 DLL1 (hs00194509_m1) Thermo Fischer Scientific Cat# 4331182 GAPDH (hs99999905) Thermo Fischer Scientific Cat# 4326317E Gapdh (mm99999915_g1) Thermo Fischer Scientific Cat# 4352932E GJA4 (hs00704917_s1) Thermo Fischer Scientific Cat# 4331182 Hey1 (mm00468865_m1) Thermo Fischer Scientific Cat# 4331182 miR-139-5p (MI0000693) Thermo Fischer Scientific Cat# 002289 Mki67 (mm01278617_m1) Thermo Fischer Scientific Cat# 4331182 PDE10A (hs01098928_m1) Thermo Fischer Scientific Cat# 4351372 PDE12 (hs00698272_m1) Thermo Fischer Scientific Cat# 4331182 PDE2A (hs00159935_m1) Thermo Fischer Scientific Cat# 4331182 Pde2a (mm01136644_m1) Thermo Fischer Scientific Cat# 4331182 PDE3A (hs01012698_m1) Thermo Fischer Scientific Cat# 4331182 PDE4B (hs00963643_m1) Thermo Fischer Scientific Cat# 4331182 PDE4D (hs01579625_m1) Thermo Fischer Scientific Cat# 4331182 PDE6D (hs01062025_m1) Thermo Fischer Scientific Cat# 4331182 PDE8A (hs01079617_m1) Thermo Fischer Scientific Cat# 4331182 PSEN2 (hs01577197_m1) Thermo Fischer Scientific Cat# 4331182 RNU48 (TaqMan MicroRNA Assay) Thermo Fischer Scientific Cat# 001006 snoRNA202 (TaqMan MicroRNA Assay) Thermo Fischer Scientific Cat# 001232 snoRNA234 (TaqMan MicroRNA Assay) Thermo Fischer Scientific Cat# 001234 Pde2a-5’-arm 50ACTGGTCAGTTCTGAGC CTCACCC 30 This paper N/A Pde2a-3’-arm 50 AGTCTGGACTCCCCA TCTAGCAGG 30 This paper N/A Cre transgene sense 50GAACCTGATGG ACATGTTCAGG 30 This paper N/A Cre transgene antisense 50 AGTGCGTT CGAACGCTAGAGCCTGT 30 This paper N/A Myogenin sense 50 TTACGTCCA TCGTGGACAGC 30 This paper N/A Myogenin antisense 50 TGGGCTGGGT GTTAGCCTTA 30 This paper N/A (Continued on next page) e4 Developmental Cell 59, 1–18.e1–e11, February 5, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER Software and algorithms BioRad Image Lab Software BioRad N/A Diva 8.0.1 software BD Biosciences N/A Fiji ImageJ N/A https://imagej.net/ij/ GraphPad Prism 9 Dotmatics N/A Leica LAS-X software Leica N/A MicroManager 1.4 software Open source N/A Seurat package Satija et al.72 https://www.nature.com/articles/nbt.3192 umap package McInnes et al.73 https://joss.theoj.org/papers/10.21105/ joss.00861 Plotly software Open source https://plotly.com/r/ FastQC (v0.11.9) Open source http://www.bioinformatics.babraham.ac. uk/projects/fastqc/ Trimmomatic (v0.36) Bolger et al.74 https://academic.oup.com/bioinformatics/ article/30/15/2114/2390096?login=true STAR (v2.7.3a) Dobin et al.75 https://academic.oup.com/bioinformatics/ article/29/1/15/272537 ComBat-seq Zhang et al.76 https://academic.oup.com/nargab/article/ 2/3/lqaa078/5909519?searchresult=1 WebGestalt platform 2019 Liao et al.77 https://academic.oup.com/nar/article/47/ W1/W199/5494758?login=true Other 24-well Plate Softwell Easy Coat hydrogels (0.1, 1, 2, 4 and 25kPa) Matrigen Cat# SS24-EC 8-well Lab-Tek II chamber slides Lab-Tek Cat# 154941 Agilent Technologies 2100 bioanalyzer Agilent https://www.agilent.com/en/product/ automated-electrophoresis/bioanalyzersystems/bioanalyzer-instrument AMPure XP magnetic beads Beckman Cat# A53880 Axiocam 208 Color Zeiss N/A BD Biosciences FACSAria IIIu BD Biosciences N/A CoolLED beam-splitter DV2 Dual View Photometrics N/A CMOS camera chip OptiMOS, Qimaging N/A DEAE-Sephadex A-25 columns Cytiva Cat# 17017001 DynaMag -2 Invitrogen Cat# 12321D Gel Doc MP Imaging System BioRad N/A Hamilton TLC syringe Sigma-Aldrich Cat# HAM7635-01-1EA Immobilion -P Transfer Membrane (0.45mm pore size) Merck Cat# IPVH00010 Inject -F syringe Braun Cat# 9166017V Leica DMI 3000 B inverted fluorescent microscope Leica N/A Leica SP8 inverted microscope Leica N/A Nikon Eclipse Ts2R microscope Nikon N/A Sheep-anti-rat IgG Dynabeads Invitrogen Cat# 110-35 StepOnePlus RT PCR system Applied Biosystems N/A Tecan Spark 10M microplate reader Tecan N/A Tissue culture-treated dishes Corning Cat# 430167 Tissue culture-treated dishes (60mm) Corning Cat# 430166 Transwell filters (0.4mm pore size) Corning Cat# 3413 (Continued on next page) Developmental Cell 59, 1–18.e1–e11, February 5, 2024 e5 .. REAGENT or RESOURCE SOURCE IDENTIFIER Tri-Carb 2100TR Liquid Scintillation Counter Packard Instruments Cat# 2000CA ULTIMA GOLD scintillation liquid PerkinElmer Cat# 6013326 UltraComp eBeads Plus Compensation Beads Invitrogen Cat# 01-3333-42 Zeiss Stemi 508 Zeiss N/A

    Inverted Microscopy:

    Article Title: The phosphodiesterase 2A controls lymphatic junctional maturation via cGMP-dependent notch signaling.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Experimental models: Cell lines HDLECs PromoCell Cat# C-12216 HUVECs PromoCell Cat# C-12203 mECs This manuscript N/A Experimental models: Organisms/strains Mouse: Tie2-Cre (B6.Cg-Tg(Tek-cre) 1Ywa/J) Kisanuki et al.69 RRID:IMSR_JAX:008863 Mouse: Cdh5-CreERT2 (Tg(Cdh5-cre/ ERT2)1Rha) Sörensen et al.70 RRID:IMSR_EM:14891 Mouse: Prox1-CreERT2 (Tg(Prox1-cre/ ERT2)1Tmak Bazigou et al.71 RRID:IMSR_EM:13737 Mouse: Pde2a global knockout (B6; 129P2487Pde2A < tm1Dgen>/H; EM: 02366) Assenza et al.25 RRID:IMSR_EM:02366 Mouse: Pde2a (Pde2atm1a(EUCOMM)Wtsl) This manuscript N/A Oligonucleotides AllStars Negative CTRL siRNA Qiagen Cat# 1027281 FlexiTube PDE2A siRNA Qiagen Cat# SI00040159 DLL1 (hs00194509_m1) Thermo Fischer Scientific Cat# 4331182 GAPDH (hs99999905) Thermo Fischer Scientific Cat# 4326317E Gapdh (mm99999915_g1) Thermo Fischer Scientific Cat# 4352932E GJA4 (hs00704917_s1) Thermo Fischer Scientific Cat# 4331182 Hey1 (mm00468865_m1) Thermo Fischer Scientific Cat# 4331182 miR-139-5p (MI0000693) Thermo Fischer Scientific Cat# 002289 Mki67 (mm01278617_m1) Thermo Fischer Scientific Cat# 4331182 PDE10A (hs01098928_m1) Thermo Fischer Scientific Cat# 4351372 PDE12 (hs00698272_m1) Thermo Fischer Scientific Cat# 4331182 PDE2A (hs00159935_m1) Thermo Fischer Scientific Cat# 4331182 Pde2a (mm01136644_m1) Thermo Fischer Scientific Cat# 4331182 PDE3A (hs01012698_m1) Thermo Fischer Scientific Cat# 4331182 PDE4B (hs00963643_m1) Thermo Fischer Scientific Cat# 4331182 PDE4D (hs01579625_m1) Thermo Fischer Scientific Cat# 4331182 PDE6D (hs01062025_m1) Thermo Fischer Scientific Cat# 4331182 PDE8A (hs01079617_m1) Thermo Fischer Scientific Cat# 4331182 PSEN2 (hs01577197_m1) Thermo Fischer Scientific Cat# 4331182 RNU48 (TaqMan MicroRNA Assay) Thermo Fischer Scientific Cat# 001006 snoRNA202 (TaqMan MicroRNA Assay) Thermo Fischer Scientific Cat# 001232 snoRNA234 (TaqMan MicroRNA Assay) Thermo Fischer Scientific Cat# 001234 Pde2a-5’-arm 50ACTGGTCAGTTCTGAGC CTCACCC 30 This paper N/A Pde2a-3’-arm 50 AGTCTGGACTCCCCA TCTAGCAGG 30 This paper N/A Cre transgene sense 50GAACCTGATGG ACATGTTCAGG 30 This paper N/A Cre transgene antisense 50 AGTGCGTT CGAACGCTAGAGCCTGT 30 This paper N/A Myogenin sense 50 TTACGTCCA TCGTGGACAGC 30 This paper N/A Myogenin antisense 50 TGGGCTGGGT GTTAGCCTTA 30 This paper N/A (Continued on next page) e4 Developmental Cell 59, 1–18.e1–e11, February 5, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER Software and algorithms BioRad Image Lab Software BioRad N/A Diva 8.0.1 software BD Biosciences N/A Fiji ImageJ N/A https://imagej.net/ij/ GraphPad Prism 9 Dotmatics N/A Leica LAS-X software Leica N/A MicroManager 1.4 software Open source N/A Seurat package Satija et al.72 https://www.nature.com/articles/nbt.3192 umap package McInnes et al.73 https://joss.theoj.org/papers/10.21105/ joss.00861 Plotly software Open source https://plotly.com/r/ FastQC (v0.11.9) Open source http://www.bioinformatics.babraham.ac. uk/projects/fastqc/ Trimmomatic (v0.36) Bolger et al.74 https://academic.oup.com/bioinformatics/ article/30/15/2114/2390096?login=true STAR (v2.7.3a) Dobin et al.75 https://academic.oup.com/bioinformatics/ article/29/1/15/272537 ComBat-seq Zhang et al.76 https://academic.oup.com/nargab/article/ 2/3/lqaa078/5909519?searchresult=1 WebGestalt platform 2019 Liao et al.77 https://academic.oup.com/nar/article/47/ W1/W199/5494758?login=true Other 24-well Plate Softwell Easy Coat hydrogels (0.1, 1, 2, 4 and 25kPa) Matrigen Cat# SS24-EC 8-well Lab-Tek II chamber slides Lab-Tek Cat# 154941 Agilent Technologies 2100 bioanalyzer Agilent https://www.agilent.com/en/product/ automated-electrophoresis/bioanalyzersystems/bioanalyzer-instrument AMPure XP magnetic beads Beckman Cat# A53880 Axiocam 208 Color Zeiss N/A BD Biosciences FACSAria IIIu BD Biosciences N/A CoolLED beam-splitter DV2 Dual View Photometrics N/A CMOS camera chip OptiMOS, Qimaging N/A DEAE-Sephadex A-25 columns Cytiva Cat# 17017001 DynaMag -2 Invitrogen Cat# 12321D Gel Doc MP Imaging System BioRad N/A Hamilton TLC syringe Sigma-Aldrich Cat# HAM7635-01-1EA Immobilion -P Transfer Membrane (0.45mm pore size) Merck Cat# IPVH00010 Inject -F syringe Braun Cat# 9166017V Leica DMI 3000 B inverted fluorescent microscope Leica N/A Leica SP8 inverted microscope Leica N/A Nikon Eclipse Ts2R microscope Nikon N/A Sheep-anti-rat IgG Dynabeads Invitrogen Cat# 110-35 StepOnePlus RT PCR system Applied Biosystems N/A Tecan Spark 10M microplate reader Tecan N/A Tissue culture-treated dishes Corning Cat# 430167 Tissue culture-treated dishes (60mm) Corning Cat# 430166 Transwell filters (0.4mm pore size) Corning Cat# 3413 (Continued on next page) Developmental Cell 59, 1–18.e1–e11, February 5, 2024 e5 .. REAGENT or RESOURCE SOURCE IDENTIFIER Tri-Carb 2100TR Liquid Scintillation Counter Packard Instruments Cat# 2000CA ULTIMA GOLD scintillation liquid PerkinElmer Cat# 6013326 UltraComp eBeads Plus Compensation Beads Invitrogen Cat# 01-3333-42 Zeiss Stemi 508 Zeiss N/A

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: The phosphodiesterase 2A controls lymphatic junctional maturation via cGMP-dependent notch signaling.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Experimental models: Cell lines HDLECs PromoCell Cat# C-12216 HUVECs PromoCell Cat# C-12203 mECs This manuscript N/A Experimental models: Organisms/strains Mouse: Tie2-Cre (B6.Cg-Tg(Tek-cre) 1Ywa/J) Kisanuki et al.69 RRID:IMSR_JAX:008863 Mouse: Cdh5-CreERT2 (Tg(Cdh5-cre/ ERT2)1Rha) Sörensen et al.70 RRID:IMSR_EM:14891 Mouse: Prox1-CreERT2 (Tg(Prox1-cre/ ERT2)1Tmak Bazigou et al.71 RRID:IMSR_EM:13737 Mouse: Pde2a global knockout (B6; 129P2487Pde2A < tm1Dgen>/H; EM: 02366) Assenza et al.25 RRID:IMSR_EM:02366 Mouse: Pde2a (Pde2atm1a(EUCOMM)Wtsl) This manuscript N/A Oligonucleotides AllStars Negative CTRL siRNA Qiagen Cat# 1027281 FlexiTube PDE2A siRNA Qiagen Cat# SI00040159 DLL1 (hs00194509_m1) Thermo Fischer Scientific Cat# 4331182 GAPDH (hs99999905) Thermo Fischer Scientific Cat# 4326317E Gapdh (mm99999915_g1) Thermo Fischer Scientific Cat# 4352932E GJA4 (hs00704917_s1) Thermo Fischer Scientific Cat# 4331182 Hey1 (mm00468865_m1) Thermo Fischer Scientific Cat# 4331182 miR-139-5p (MI0000693) Thermo Fischer Scientific Cat# 002289 Mki67 (mm01278617_m1) Thermo Fischer Scientific Cat# 4331182 PDE10A (hs01098928_m1) Thermo Fischer Scientific Cat# 4351372 PDE12 (hs00698272_m1) Thermo Fischer Scientific Cat# 4331182 PDE2A (hs00159935_m1) Thermo Fischer Scientific Cat# 4331182 Pde2a (mm01136644_m1) Thermo Fischer Scientific Cat# 4331182 PDE3A (hs01012698_m1) Thermo Fischer Scientific Cat# 4331182 PDE4B (hs00963643_m1) Thermo Fischer Scientific Cat# 4331182 PDE4D (hs01579625_m1) Thermo Fischer Scientific Cat# 4331182 PDE6D (hs01062025_m1) Thermo Fischer Scientific Cat# 4331182 PDE8A (hs01079617_m1) Thermo Fischer Scientific Cat# 4331182 PSEN2 (hs01577197_m1) Thermo Fischer Scientific Cat# 4331182 RNU48 (TaqMan MicroRNA Assay) Thermo Fischer Scientific Cat# 001006 snoRNA202 (TaqMan MicroRNA Assay) Thermo Fischer Scientific Cat# 001232 snoRNA234 (TaqMan MicroRNA Assay) Thermo Fischer Scientific Cat# 001234 Pde2a-5’-arm 50ACTGGTCAGTTCTGAGC CTCACCC 30 This paper N/A Pde2a-3’-arm 50 AGTCTGGACTCCCCA TCTAGCAGG 30 This paper N/A Cre transgene sense 50GAACCTGATGG ACATGTTCAGG 30 This paper N/A Cre transgene antisense 50 AGTGCGTT CGAACGCTAGAGCCTGT 30 This paper N/A Myogenin sense 50 TTACGTCCA TCGTGGACAGC 30 This paper N/A Myogenin antisense 50 TGGGCTGGGT GTTAGCCTTA 30 This paper N/A (Continued on next page) e4 Developmental Cell 59, 1–18.e1–e11, February 5, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER Software and algorithms BioRad Image Lab Software BioRad N/A Diva 8.0.1 software BD Biosciences N/A Fiji ImageJ N/A https://imagej.net/ij/ GraphPad Prism 9 Dotmatics N/A Leica LAS-X software Leica N/A MicroManager 1.4 software Open source N/A Seurat package Satija et al.72 https://www.nature.com/articles/nbt.3192 umap package McInnes et al.73 https://joss.theoj.org/papers/10.21105/ joss.00861 Plotly software Open source https://plotly.com/r/ FastQC (v0.11.9) Open source http://www.bioinformatics.babraham.ac. uk/projects/fastqc/ Trimmomatic (v0.36) Bolger et al.74 https://academic.oup.com/bioinformatics/ article/30/15/2114/2390096?login=true STAR (v2.7.3a) Dobin et al.75 https://academic.oup.com/bioinformatics/ article/29/1/15/272537 ComBat-seq Zhang et al.76 https://academic.oup.com/nargab/article/ 2/3/lqaa078/5909519?searchresult=1 WebGestalt platform 2019 Liao et al.77 https://academic.oup.com/nar/article/47/ W1/W199/5494758?login=true Other 24-well Plate Softwell Easy Coat hydrogels (0.1, 1, 2, 4 and 25kPa) Matrigen Cat# SS24-EC 8-well Lab-Tek II chamber slides Lab-Tek Cat# 154941 Agilent Technologies 2100 bioanalyzer Agilent https://www.agilent.com/en/product/ automated-electrophoresis/bioanalyzersystems/bioanalyzer-instrument AMPure XP magnetic beads Beckman Cat# A53880 Axiocam 208 Color Zeiss N/A BD Biosciences FACSAria IIIu BD Biosciences N/A CoolLED beam-splitter DV2 Dual View Photometrics N/A CMOS camera chip OptiMOS, Qimaging N/A DEAE-Sephadex A-25 columns Cytiva Cat# 17017001 DynaMag -2 Invitrogen Cat# 12321D Gel Doc MP Imaging System BioRad N/A Hamilton TLC syringe Sigma-Aldrich Cat# HAM7635-01-1EA Immobilion -P Transfer Membrane (0.45mm pore size) Merck Cat# IPVH00010 Inject -F syringe Braun Cat# 9166017V Leica DMI 3000 B inverted fluorescent microscope Leica N/A Leica SP8 inverted microscope Leica N/A Nikon Eclipse Ts2R microscope Nikon N/A Sheep-anti-rat IgG Dynabeads Invitrogen Cat# 110-35 StepOnePlus RT PCR system Applied Biosystems N/A Tecan Spark 10M microplate reader Tecan N/A Tissue culture-treated dishes Corning Cat# 430167 Tissue culture-treated dishes (60mm) Corning Cat# 430166 Transwell filters (0.4mm pore size) Corning Cat# 3413 (Continued on next page) Developmental Cell 59, 1–18.e1–e11, February 5, 2024 e5 .. REAGENT or RESOURCE SOURCE IDENTIFIER Tri-Carb 2100TR Liquid Scintillation Counter Packard Instruments Cat# 2000CA ULTIMA GOLD scintillation liquid PerkinElmer Cat# 6013326 UltraComp eBeads Plus Compensation Beads Invitrogen Cat# 01-3333-42 Zeiss Stemi 508 Zeiss N/A



    Similar Products

    cytonuclear v1 5 image analysis algorithm  (Indica Labs)
    86
    Indica Labs cytonuclear v1 5 image analysis algorithm
    Cytonuclear V1 5 Image Analysis Algorithm, supplied by Indica Labs, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/imaging+algorithms/algorithm+deconvolution+halo/pm41933194-250-13-11
    Average 86 stars, based on 1 article reviews
    cytonuclear v1 5 image analysis algorithm - by Bioz Stars, 2026-09
    86/100 stars
    		  Buy from Supplier
    algorithms licor odyssey fc system licor bio  (LI-COR)
    99
    LI-COR algorithms licor odyssey fc system licor bio
    Algorithms Licor Odyssey Fc System Licor Bio, supplied by LI-COR, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/imaging+algorithms/Odyssey+FC+Imaging+System/pm41763203-254-169-170
    Average 99 stars, based on 1 article reviews
    algorithms licor odyssey fc system licor bio - by Bioz Stars, 2026-09
    99/100 stars
    		  Buy from Supplier
    imaging algorithms  (Simpleware Ltd)
    86
    Simpleware Ltd imaging algorithms
    Imaging Algorithms, supplied by Simpleware Ltd, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/imaging+algorithms/algorithms+imaging/pmc13002731-81-15-18
    Average 86 stars, based on 1 article reviews
    imaging algorithms - by Bioz Stars, 2026-09
    86/100 stars
    		  Buy from Supplier
    algorithms imagelab biorad ver  (Bio-Rad)
    99
    Bio-Rad algorithms imagelab biorad ver
    Algorithms Imagelab Biorad Ver, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/imaging+algorithms/Image+Lab+Software/pm41746804-125-133-135
    Average 99 stars, based on 1 article reviews
    algorithms imagelab biorad ver - by Bioz Stars, 2026-09
    99/100 stars
    		  Buy from Supplier
    algorithms chemidoc mp imaging system bio rad  (Bio-Rad)
    99
    Bio-Rad algorithms chemidoc mp imaging system bio rad
    Algorithms Chemidoc Mp Imaging System Bio Rad, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/imaging+algorithms/ChemiDoc+MP+Imaging+System/pm41672063-258-171-176
    Average 99 stars, based on 1 article reviews
    algorithms chemidoc mp imaging system bio rad - by Bioz Stars, 2026-09
    99/100 stars
    		  Buy from Supplier
    algorithms image lab software bio rad imagej nih rrid scr 001935 url  (Bio-Rad)
    99
    Bio-Rad algorithms image lab software bio rad imagej nih rrid scr 001935 url
    Algorithms Image Lab Software Bio Rad Imagej Nih Rrid Scr 001935 Url, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/imaging+algorithms/Image+Lab+Software/pm41512867-588-28-32
    Average 99 stars, based on 1 article reviews
    algorithms image lab software bio rad imagej nih rrid scr 001935 url - by Bioz Stars, 2026-09
    99/100 stars
    		  Buy from Supplier
    matlab algorithms  (MathWorks Inc)
    96
    MathWorks Inc matlab algorithms
    Matlab Algorithms, supplied by MathWorks Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/imaging+algorithms/Image+Processing+Toolbox/10__1021_slash_acsaenm__5c00861-78-21-21
    Average 96 stars, based on 1 article reviews
    matlab algorithms - by Bioz Stars, 2026-09
    96/100 stars
    		  Buy from Supplier
    algorithms imagej  (Bio-Rad)
    99
    Bio-Rad algorithms imagej
    Algorithms Imagej, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/imaging+algorithms/Image+Lab+Software/pm41308649-359-79-86
    Average 99 stars, based on 1 article reviews
    algorithms imagej - by Bioz Stars, 2026-09
    99/100 stars
    		  Buy from Supplier
    algorithms image lab  (Bio-Rad)
    99
    Bio-Rad algorithms image lab
    Algorithms Image Lab, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/imaging+algorithms/Image+Lab+Software/pm41205174-312-55-60
    Average 99 stars, based on 1 article reviews
    algorithms image lab - by Bioz Stars, 2026-09
    99/100 stars
    		  Buy from Supplier

    Image Search Results